github/elm
1
0
Fork 0
mirror of https://github.com/correl/elm.git synced 2024-12-18 11:06:17 +00:00
Code Issues Projects Releases Packages Wiki Activity

Update to elm-test 2.0 (#96)

Browse source 
* Update exercises to elm-test 2.0

* Update docs to mention `elm-test` again

* Update .travis.yml to the correct version of elm-test

* Conform to the `<| \() ->` convention
This commit is contained in:
Erik Simmler 2016-08-17 07:14:17 -04:00 committed by GitHub
parent 4999d42ab5
commit 54e3017815
118 changed files with 1441 additions and 1238 deletions
Show stats Download patch file Download diff file Expand all files Collapse all files

6
.travis.yml
View file

@ -5,9 +5,9 @@ language: bash
sudo: false
install:
- nvm install 0.12
- nvm use 0.12
- npm install -g elm@0.17.0 elm-test@0.16.1-alpha4
- nvm install 6
- nvm use 6
- npm install -g elm@0.17.1 elm-test@0.17.1
- elm package install -y
script:

3
bin/build.sh
View file

@ -12,7 +12,8 @@ do
echo '-------------------------------------------------------'
echo "Testing $exercise"
elm-make $exercise_dir/*Tests.elm --yes --output build.js && node build.js
elm-package install
elm-test $exercise_dir/*Tests.elm
if [ $? -ne 0 ]; then
TEST_RESULT=1

4
docs/INSTALLATION.md
View file

@ -2,8 +2,8 @@
The simplest way to install Elm is via Node.js/NPM.
If you don't already have Node.js installed on your computer, you can download it from [the official site](https://nodejs.org/). Once you have Node.js up and running, follow these steps to install the Elm platform.
If you don't already have Node.js installed on your computer, you can download it from [the official site](https://nodejs.org/). Once you have Node.js up and running, follow these steps to install the Elm platform and `elm-test`.
```bash
$ npm install --global elm
$ npm install --global elm elm-test
```

4
docs/TESTS.md
View file

@ -1,8 +1,8 @@
Elm exercises within your exercism project directory can be run by changing to the exercise directory, and running `./runtests.sh` (or `runtests.bat` on Windows).
The Elm exercise test suites may be run from the exercise directory.
```bash
$ cd exercism/project/directory/elm/hello-world
$ ./runtests.sh
$ elm-test *Tests.elm
```
## Hints and tips

5
elm-package.json
View file

@ -36,8 +36,9 @@
],
"exposed-modules": [],
"dependencies": {
"elm-community/elm-test": "1.0.0 <= v < 2.0.0",
"elm-lang/core": "4.0.0 <= v < 5.0.0"
"elm-lang/core": "4.0.0 <= v < 5.0.0",
"elm-community/elm-test": "2.0.0 <= v < 3.0.0",
"rtfeldman/node-test-runner": "1.0.0 <= v < 2.0.0"
},
"elm-version": "0.17.0 <= v < 0.18.0"
}

34
exercises/accumulate/AccumulateTests.elm
View file

@ -1,6 +1,9 @@
module Main exposing (..)
port module Main exposing (..)
import ElmTest exposing (..)
import Test.Runner.Node exposing (run)
import Json.Encode exposing (Value)
import Test exposing (..)
import Expect
import Accumulate exposing (accumulate)
import String
@ -12,18 +15,25 @@ square x =
tests : Test
tests =
suite "Accumulate"
[ test "[]] Accumulate"
(assertEqual [] (accumulate square []))
, test "square Accumulate"
(assertEqual [ 1, 4, 9 ] (accumulate square [ 1, 2, 3 ]))
, test "toUpper Accumulate"
(assertEqual [ "HELLO", "WORLD" ] (accumulate String.toUpper [ "hello", "world" ]))
, test "reverse Accumulate"
(assertEqual [ "olleh", "dlrow" ] (accumulate String.reverse [ "hello", "world" ]))
describe "Accumulate"
[ test "[]] Accumulate" <|
\() -> Expect.equal [] (accumulate square [])
, test "square Accumulate" <|
\() -> Expect.equal [ 1, 4, 9 ] (accumulate square [ 1, 2, 3 ])
, test "toUpper Accumulate" <|
\() ->
Expect.equal [ "HELLO", "WORLD" ]
(accumulate String.toUpper [ "hello", "world" ])
, test "reverse Accumulate" <|
\() ->
Expect.equal [ "olleh", "dlrow" ]
(accumulate String.reverse [ "hello", "world" ])
]
main : Program Never
main =
runSuite tests
run emit tests
port emit : ( String, Value ) -> Cmd msg

7
exercises/accumulate/elm-package.json
View file

@ -1,5 +1,5 @@
{
"version": "2.0.0",
"version": "3.0.0",
"summary": "Exercism problems in Elm.",
"repository": "https://github.com/exercism/xelm.git",
"license": "BSD3",
@ -8,8 +8,9 @@
],
"exposed-modules": [],
"dependencies": {
"elm-community/elm-test": "1.0.0 <= v < 2.0.0",
"elm-lang/core": "4.0.0 <= v < 5.0.0"
"elm-lang/core": "4.0.0 <= v < 5.0.0",
"elm-community/elm-test": "2.0.0 <= v < 3.0.0",
"rtfeldman/node-test-runner": "1.0.0 <= v < 2.0.0"
},
"elm-version": "0.17.0 <= v < 0.18.0"
}

4
exercises/accumulate/runtests.bat
View file

@ -1,4 +0,0 @@
@echo off
for %%f in (*Tests.elm) do (
elm-make %%f --yes --output build.js && node build.js
)

2
exercises/accumulate/runtests.sh
View file

@ -1,2 +0,0 @@
#!/usr/bin/env bash
elm-make *Tests.elm --yes --output build.js && node build.js

78
exercises/allergies/AllergiesTests.elm
View file

@ -1,52 +1,58 @@
module Main exposing (..)
port module Main exposing (..)
import ElmTest exposing (..)
import Test.Runner.Node exposing (run)
import Json.Encode exposing (Value)
import Test exposing (..)
import Expect
import Allergies exposing (isAllergicTo, toList)
import List
tests : Test
tests =
suite "Allergies"
[ suite "isAllergicTo"
[ suite "no allergies means not allergic"
[ test "peanuts"
(assert (not (isAllergicTo "peanuts" 0)))
, test "cats"
(assert (not (isAllergicTo "cats" 0)))
, test "strawberries"
(assert (not (isAllergicTo "strawberries" 0)))
describe "Allergies"
[ describe "isAllergicTo"
[ describe "no allergies means not allergic"
[ test "peanuts" <|
\() -> Expect.equal False (isAllergicTo "peanuts" 0)
, test "cats" <|
\() -> Expect.equal False (isAllergicTo "cats" 0)
, test "strawberries" <|
\() -> Expect.equal False (isAllergicTo "strawberries" 0)
]
, test "is allergic to eggs"
(assert (isAllergicTo "eggs" 1))
, suite "has the right allergies"
[ test "eggs"
(assert (isAllergicTo "eggs" 5))
, test "shellfish"
(assert (isAllergicTo "shellfish" 5))
, test "strawberries"
(assert (not (isAllergicTo "strawberries" 5)))
, test "is allergic to eggs" <|
\() -> Expect.equal True (isAllergicTo "eggs" 1)
, describe "has the right allergies"
[ test "eggs" <|
\() -> Expect.equal True (isAllergicTo "eggs" 5)
, test "shellfish" <|
\() -> Expect.equal True (isAllergicTo "shellfish" 5)
, test "strawberries" <|
\() -> Expect.equal False (isAllergicTo "strawberries" 5)
]
]
, suite "toList"
[ test "no allergies at all"
(assertEqual [] (toList (0)))
, test "allergic to just peanuts"
(assertEqual [ "peanuts" ] (toList (2)))
, test "allergic to everything"
(assertEqual (List.sort [ "eggs", "peanuts", "shellfish", "strawberries", "tomatoes", "chocolate", "pollen", "cats" ])
(255 |> toList |> List.sort)
)
, test "ignore non allergen score parts"
(assertEqual [ "eggs" ] (toList 257))
, test "ignore non allergen score parts"
(assertEqual (List.sort [ "eggs", "shellfish", "strawberries", "tomatoes", "chocolate", "pollen", "cats" ])
(509 |> toList |> List.sort)
)
, describe "toList"
[ test "no allergies at all" <|
\() -> Expect.equal [] (toList (0))
, test "allergic to just peanuts" <|
\() -> Expect.equal [ "peanuts" ] (toList (2))
, test "allergic to everything" <|
\() ->
Expect.equal (List.sort [ "eggs", "peanuts", "shellfish", "strawberries", "tomatoes", "chocolate", "pollen", "cats" ])
(255 |> toList |> List.sort)
, test "ignore non allergen score parts" <|
\() -> Expect.equal [ "eggs" ] (toList 257)
, test "ignore non allergen score parts" <|
\() ->
Expect.equal (List.sort [ "eggs", "shellfish", "strawberries", "tomatoes", "chocolate", "pollen", "cats" ])
(509 |> toList |> List.sort)
]
]
main : Program Never
main =
runSuite tests
run emit tests
port emit : ( String, Value ) -> Cmd msg

7
exercises/allergies/elm-package.json
View file

@ -1,5 +1,5 @@
{
"version": "2.0.0",
"version": "3.0.0",
"summary": "Exercism problems in Elm.",
"repository": "https://github.com/exercism/xelm.git",
"license": "BSD3",
@ -8,8 +8,9 @@
],
"exposed-modules": [],
"dependencies": {
"elm-community/elm-test": "1.0.0 <= v < 2.0.0",
"elm-lang/core": "4.0.0 <= v < 5.0.0"
"elm-lang/core": "4.0.0 <= v < 5.0.0",
"elm-community/elm-test": "2.0.0 <= v < 3.0.0",
"rtfeldman/node-test-runner": "1.0.0 <= v < 2.0.0"
},
"elm-version": "0.17.0 <= v < 0.18.0"
}

4
exercises/allergies/runtests.bat
View file

@ -1,4 +0,0 @@
@echo off
for %%f in (*Tests.elm) do (
elm-make %%f --yes --output build.js && node build.js
)

2
exercises/allergies/runtests.sh
View file

@ -1,2 +0,0 @@
#!/usr/bin/env bash
elm-make *Tests.elm --yes --output build.js && node build.js

174
exercises/anagram/AnagramTests.elm
View file

@ -1,95 +1,101 @@
module Main exposing (..)
port module Main exposing (..)
import ElmTest exposing (..)
import Test.Runner.Node exposing (run)
import Json.Encode exposing (Value)
import Test exposing (..)
import Expect
import Anagram exposing (detect)
tests : Test
tests =
suite "Anagram"
[ test "no matches"
(assertEqual []
(detect "diaper" [ "hello", "world", "zombies", "pants" ])
)
, test "detects simple anagram"
(assertEqual [ "tan" ]
(detect "ant" [ "tan", "stand", "at" ])
)
, test "does not detect false positives"
(assertEqual []
(detect "galea" [ "eagle" ])
)
, test "detects multiple anagrams"
(assertEqual [ "stream", "maters" ]
(detect "master" [ "stream", "pigeon", "maters" ])
)
, test "does not detect anagram subsets"
(assertEqual []
(detect "good" [ "dog", "goody" ])
)
, test "detects anagram"
(assertEqual [ "inlets" ]
(detect "listen" [ "enlists", "google", "inlets", "banana" ])
)
, test "detects multiple anagrams"
(assertEqual [ "gallery", "regally", "largely" ]
(detect "allergy" [ "gallery", "ballerina", "regally", "clergy", "largely", "leading" ])
)
, test "does not detect indentical words"
(assertEqual [ "cron" ]
(detect "corn" [ "corn", "dark", "Corn", "rank", "CORN", "cron", "park" ])
)
, test "does not detect non-anagrams with identical checksum"
(assertEqual []
(detect "mass" [ "last" ])
)
, test "detects anagrams case-insensitively"
(assertEqual [ "Carthorse" ]
(detect "Orchestra" [ "cashregister", "Carthorse", "radishes" ])
)
, test "detects anagrams using case-insensitive subject"
(assertEqual [ "carthorse" ]
(detect "Orchestra" [ "cashregister", "carthorse", "radishes" ])
)
, test "detects anagrams using case-insensitve possible matches"
(assertEqual [ "Carthorse" ]
(detect "orchestra" [ "cashregister", "Carthorse", "radishes" ])
)
, test "does not detect a word as its own anagram"
(assertEqual []
(detect "banana" [ "Banana" ])
)
, test "does not detect a anagram if the original word is repeated"
(assertEqual []
(detect "go" [ "go Go GO" ])
)
, test "anagrams must use all letters exactly once"
(assertEqual []
(detect "tapper" [ "patter" ])
)
, test "eliminates anagrams with the same checksum"
(assertEqual []
(detect "mass" [ "last" ])
)
, test "detects unicode anagrams"
(assertEqual [ "ΒΓΑ", "γβα" ]
(detect "ΑΒΓ" [ "ΒΓΑ", "ΒΓΔ", "γβα" ])
)
, test "eliminates misleading unicode anagrams"
(assertEqual []
(detect "ΑΒΓ" [ "ABΓ" ])
)
, test "capital word is not own anagram"
(assertEqual []
(detect "BANANA" [ "Banana" ])
)
, test "anagrams must use all letters exactly once"
(assertEqual []
(detect "patter" [ "tapper" ])
)
describe "Anagram"
[ test "no matches" <|
\() ->
Expect.equal []
(detect "diaper" [ "hello", "world", "zombies", "pants" ])
, test "detects simple anagram" <|
\() ->
Expect.equal [ "tan" ]
(detect "ant" [ "tan", "stand", "at" ])
, test "does not detect false positives" <|
\() ->
Expect.equal []
(detect "galea" [ "eagle" ])
, test "detects multiple anagrams" <|
\() ->
Expect.equal [ "stream", "maters" ]
(detect "master" [ "stream", "pigeon", "maters" ])
, test "does not detect anagram subsets" <|
\() ->
Expect.equal []
(detect "good" [ "dog", "goody" ])
, test "detects anagram" <|
\() ->
Expect.equal [ "inlets" ]
(detect "listen" [ "enlists", "google", "inlets", "banana" ])
, test "detects multiple anagrams" <|
\() ->
Expect.equal [ "gallery", "regally", "largely" ]
(detect "allergy" [ "gallery", "ballerina", "regally", "clergy", "largely", "leading" ])
, test "does not detect indentical words" <|
\() ->
Expect.equal [ "cron" ]
(detect "corn" [ "corn", "dark", "Corn", "rank", "CORN", "cron", "park" ])
, test "does not detect non-anagrams with identical checksum" <|
\() ->
Expect.equal []
(detect "mass" [ "last" ])
, test "detects anagrams case-insensitively" <|
\() ->
Expect.equal [ "Carthorse" ]
(detect "Orchestra" [ "cashregister", "Carthorse", "radishes" ])
, test "detects anagrams using case-insensitive subject" <|
\() ->
Expect.equal [ "carthorse" ]
(detect "Orchestra" [ "cashregister", "carthorse", "radishes" ])
, test "detects anagrams using case-insensitve possible matches" <|
\() ->
Expect.equal [ "Carthorse" ]
(detect "orchestra" [ "cashregister", "Carthorse", "radishes" ])
, test "does not detect a word as its own anagram" <|
\() ->
Expect.equal []
(detect "banana" [ "Banana" ])
, test "does not detect a anagram if the original word is repeated" <|
\() ->
Expect.equal []
(detect "go" [ "go Go GO" ])
, test "anagrams must use all letters exactly once" <|
\() ->
Expect.equal []
(detect "tapper" [ "patter" ])
, test "eliminates anagrams with the same checksum" <|
\() ->
Expect.equal []
(detect "mass" [ "last" ])
, test "detects unicode anagrams" <|
\() ->
Expect.equal [ "ΒΓΑ", "γβα" ]
(detect "ΑΒΓ" [ "ΒΓΑ", "ΒΓΔ", "γβα" ])
, test "eliminates misleading unicode anagrams" <|
\() ->
Expect.equal []
(detect "ΑΒΓ" [ "ABΓ" ])
, test "capital word is not own anagram" <|
\() ->
Expect.equal []
(detect "BANANA" [ "Banana" ])
, test "anagrams must use all letters exactly once" <|
\() ->
Expect.equal []
(detect "patter" [ "tapper" ])
]
main : Program Never
main =
runSuite tests
run emit tests
port emit : ( String, Value ) -> Cmd msg

7
exercises/anagram/elm-package.json
View file

@ -1,5 +1,5 @@
{
"version": "2.0.0",
"version": "3.0.0",
"summary": "Exercism problems in Elm.",
"repository": "https://github.com/exercism/xelm.git",
"license": "BSD3",
@ -8,8 +8,9 @@
],
"exposed-modules": [],
"dependencies": {
"elm-community/elm-test": "1.0.0 <= v < 2.0.0",
"elm-lang/core": "4.0.0 <= v < 5.0.0"
"elm-lang/core": "4.0.0 <= v < 5.0.0",
"elm-community/elm-test": "2.0.0 <= v < 3.0.0",
"rtfeldman/node-test-runner": "1.0.0 <= v < 2.0.0"
},
"elm-version": "0.17.0 <= v < 0.18.0"
}

4
exercises/anagram/runtests.bat
View file

@ -1,4 +0,0 @@
@echo off
for %%f in (*Tests.elm) do (
elm-make %%f --yes --output build.js && node build.js
)

2
exercises/anagram/runtests.sh
View file

@ -1,2 +0,0 @@
#!/usr/bin/env bash
elm-make *Tests.elm --yes --output build.js && node build.js

62
exercises/atbash-cipher/AtbashCipherTests.elm
View file

@ -1,39 +1,45 @@
module Main exposing (..)
port module Main exposing (..)
import ElmTest exposing (..)
import Test.Runner.Node exposing (run)
import Json.Encode exposing (Value)
import Test exposing (..)
import Expect
import AtbashCipher exposing (encode, decode)
tests : Test
tests =
suite "AtbashCipher"
[ test "encode no"
(assertEqual "ml" (encode "no"))
, test "encode yes"
(assertEqual "bvh" (encode "yes"))
, test "encode OMG"
(assertEqual "lnt" (encode "OMG"))
, test "encode O M G"
(assertEqual "lnt" (encode "O M G"))
, test "encode long word"
(assertEqual "nrmwy oldrm tob" (encode "mindblowingly"))
, test "encode numbers"
(assertEqual "gvhgr mt123 gvhgr mt" (encode "Testing, 1 2 3, testing."))
, test "encode sentence"
(assertEqual "gifgs rhurx grlm" (encode "Truth is fiction."))
, test "encode all things"
(assertEqual "gsvjf rxpyi ldmul cqfnk hlevi gsvoz abwlt"
(encode "The quick brown fox jumps over the lazy dog.")
)
, test "decode word"
(assertEqual "exercism" (decode "vcvix rhn"))
, test "decode sentence"
(assertEqual "anobstacleisoftenasteppingstone"
(decode "zmlyh gzxov rhlug vmzhg vkkrm thglm v")
)
describe "AtbashCipher"
[ test "encode no" <|
\() -> Expect.equal "ml" (encode "no")
, test "encode yes" <|
\() -> Expect.equal "bvh" (encode "yes")
, test "encode OMG" <|
\() -> Expect.equal "lnt" (encode "OMG")
, test "encode O M G" <|
\() -> Expect.equal "lnt" (encode "O M G")
, test "encode long word" <|
\() -> Expect.equal "nrmwy oldrm tob" (encode "mindblowingly")
, test "encode numbers" <|
\() -> Expect.equal "gvhgr mt123 gvhgr mt" (encode "Testing, 1 2 3, testing.")
, test "encode sentence" <|
\() -> Expect.equal "gifgs rhurx grlm" (encode "Truth is fiction.")
, test "encode all things" <|
\() ->
Expect.equal "gsvjf rxpyi ldmul cqfnk hlevi gsvoz abwlt"
(encode "The quick brown fox jumps over the lazy dog.")
, test "decode word" <|
\() -> Expect.equal "exercism" (decode "vcvix rhn")
, test "decode sentence" <|
\() ->
Expect.equal "anobstacleisoftenasteppingstone"
(decode "zmlyh gzxov rhlug vmzhg vkkrm thglm v")
]
main : Program Never
main =
runSuite tests
run emit tests
port emit : ( String, Value ) -> Cmd msg

7
exercises/atbash-cipher/elm-package.json
View file

@ -1,5 +1,5 @@
{
"version": "2.0.0",
"version": "3.0.0",
"summary": "Exercism problems in Elm.",
"repository": "https://github.com/exercism/xelm.git",
"license": "BSD3",
@ -8,8 +8,9 @@
],
"exposed-modules": [],
"dependencies": {
"elm-community/elm-test": "1.0.0 <= v < 2.0.0",
"elm-lang/core": "4.0.0 <= v < 5.0.0"
"elm-lang/core": "4.0.0 <= v < 5.0.0",
"elm-community/elm-test": "2.0.0 <= v < 3.0.0",
"rtfeldman/node-test-runner": "1.0.0 <= v < 2.0.0"
},
"elm-version": "0.17.0 <= v < 0.18.0"
}

4
exercises/atbash-cipher/runtests.bat
View file

@ -1,4 +0,0 @@
@echo off
for %%f in (*Tests.elm) do (
elm-make %%f --yes --output build.js && node build.js
)

2
exercises/atbash-cipher/runtests.sh
View file

@ -1,2 +0,0 @@
#!/usr/bin/env bash
elm-make *Tests.elm --yes --output build.js && node build.js

133
exercises/bob/BobTests.elm
View file

@ -1,6 +1,9 @@
module Main exposing (..)
port module Main exposing (..)
import ElmTest exposing (..)
import Test.Runner.Node exposing (run)
import Json.Encode exposing (Value)
import Test exposing (..)
import Expect
import String
import Char
import Random
@ -9,27 +12,106 @@ import Bob
tests : Test
tests =
suite "Bob"
[ test "stating something" (assertEqual "Whatever." (Bob.hey "Tom-ay-to, tom-aaaah-to."))
, test "shouting" (assertEqual "Whoa, chill out!" (Bob.hey "WATCH OUT!"))
, test "shouting gibberish" (assertEqual "Whoa, chill out!" (Bob.hey (uppercaseGibberish 10)))
, test "asking a question" (assertEqual "Sure." (Bob.hey "Does this cryogenic chamber make me look fat?"))
, test "asking a numeric question" (assertEqual "Sure." (Bob.hey "You are, what, like 15?"))
, test "asking gibberish" (assertEqual "Sure." (Bob.hey (gibberishQuestion 20)))
, test "talking forcefully" (assertEqual "Whatever." (Bob.hey "Let's go make out behind the gym!"))
, test "using acronyms in regular speech" (assertEqual "Whatever." (Bob.hey "It's OK if you don't want to go to the DMV."))
, test "forceful questions" (assertEqual "Whoa, chill out!" (Bob.hey "WHAT THE HELL WERE YOU THINKING?"))
, test "shouting numbers" (assertEqual "Whoa, chill out!" (Bob.hey "1, 2, 3 GO!"))
, test "only numbers" (assertEqual "Whatever." (Bob.hey "1, 2, 3"))
, test "question with only numbers" (assertEqual "Sure." (Bob.hey "4?"))
, test "shouting with special characters" (assertEqual "Whoa, chill out!" (Bob.hey "ZOMG THE %^*@#$(*^ ZOMBIES ARE COMING!!11!!1!)"))
, test "shouting with no exclamation mark" (assertEqual "Whoa, chill out!" (Bob.hey "I HATE YOU"))
, test "statement containing a question mark" (assertEqual "Whatever." (Bob.hey "Ending with ? means a question."))
, test "prattling on" (assertEqual "Sure." (Bob.hey "Wait! Hang on. Are you going to be OK?"))
, test "silence" (assertEqual "Fine. Be that way!" (Bob.hey ""))
, test "prolonged silence" (assertEqual "Fine. Be that way!" (Bob.hey " "))
, test "alternate silences" (assertEqual "Fine. Be that way!" (Bob.hey "\t \n \t "))
, test "on multiple line questions" (assertEqual "Whatever." (Bob.hey "\nDoes this cryogenic chamber make me look fat?\nno"))
describe "Bob"
[ test "stating something" <|
\() ->
Expect.equal "Whatever."
(Bob.hey "Tom-ay-to, tom-aaaah-to.")
, test "shouting" <|
\() ->
Expect.equal
"Whoa, chill out!"
(Bob.hey "WATCH OUT!")
, test "shouting gibberish" <|
\() ->
Expect.equal
"Whoa, chill out!"
(Bob.hey (uppercaseGibberish 10))
, test "asking a question" <|
\() ->
Expect.equal
"Sure."
(Bob.hey "Does this cryogenic chamber make me look fat?")
, test "asking a numeric question" <|
\() ->
Expect.equal
"Sure."
(Bob.hey "You are, what, like 15?")
, test "asking gibberish" <|
\() ->
Expect.equal
"Sure."
(Bob.hey (gibberishQuestion 20))
, test "talking forcefully" <|
\() ->
Expect.equal
"Whatever."
(Bob.hey "Let's go make out behind the gym!")
, test "using acronyms in regular speech" <|
\() ->
Expect.equal
"Whatever."
(Bob.hey "It's OK if you don't want to go to the DMV.")
, test "forceful questions" <|
\() ->
Expect.equal
"Whoa, chill out!"
(Bob.hey "WHAT THE HELL WERE YOU THINKING?")
, test "shouting numbers" <|
\() ->
Expect.equal
"Whoa, chill out!"
(Bob.hey "1, 2, 3 GO!")
, test "only numbers" <|
\() ->
Expect.equal
"Whatever."
(Bob.hey "1, 2, 3")
, test "question with only numbers" <|
\() ->
Expect.equal
"Sure."
(Bob.hey "4?")
, test "shouting with special characters" <|
\() ->
Expect.equal
"Whoa, chill out!"
(Bob.hey "ZOMG THE %^*@#$(*^ ZOMBIES ARE COMING!!11!!1!)")
, test "shouting with no exclamation mark" <|
\() ->
Expect.equal
"Whoa, chill out!"
(Bob.hey "I HATE YOU")
, test "statement containing a question mark" <|
\() ->
Expect.equal
"Whatever."
(Bob.hey "Ending with ? means a question.")
, test "prattling on" <|
\() ->
Expect.equal
"Sure."
(Bob.hey "Wait! Hang on. Are you going to be OK?")
, test "silence" <|
\() ->
Expect.equal
"Fine. Be that way!"
(Bob.hey "")
, test "prolonged silence" <|
\() ->
Expect.equal
"Fine. Be that way!"
(Bob.hey " ")
, test "alternate silences" <|
\() ->
Expect.equal
"Fine. Be that way!"
(Bob.hey "\t \n \t ")
, test "on multiple line questions" <|
\() ->
Expect.equal
"Whatever."
(Bob.hey "\nDoes this cryogenic chamber make me look fat?\nno")
]
@ -70,4 +152,7 @@ gibberishQuestion length =
main : Program Never
main =
runSuite tests
run emit tests
port emit : ( String, Value ) -> Cmd msg

7
exercises/bob/elm-package.json
View file

@ -1,5 +1,5 @@
{
"version": "2.0.0",
"version": "3.0.0",
"summary": "Exercism problems in Elm.",
"repository": "https://github.com/exercism/xelm.git",
"license": "BSD3",
@ -8,8 +8,9 @@
],
"exposed-modules": [],
"dependencies": {
"elm-community/elm-test": "1.0.0 <= v < 2.0.0",
"elm-lang/core": "4.0.0 <= v < 5.0.0"
"elm-lang/core": "4.0.0 <= v < 5.0.0",
"elm-community/elm-test": "2.0.0 <= v < 3.0.0",
"rtfeldman/node-test-runner": "1.0.0 <= v < 2.0.0"
},
"elm-version": "0.17.0 <= v < 0.18.0"
}

4
exercises/bob/runtests.bat
View file

@ -1,4 +0,0 @@
@echo off
for %%f in (*Tests.elm) do (
elm-make %%f --yes --output build.js && node build.js
)

2
exercises/bob/runtests.sh
View file

@ -1,2 +0,0 @@
#!/usr/bin/env bash
elm-make *Tests.elm --yes --output build.js && node build.js

50
exercises/difference-of-squares/DifferenceOfSquaresTests.elm
View file

@ -1,31 +1,47 @@
module Main exposing (..)
port module Main exposing (..)
import ElmTest exposing (..)
import Test.Runner.Node exposing (run)
import Json.Encode exposing (Value)
import Test exposing (..)
import Expect
import DifferenceOfSquares exposing (squareOfSum, sumOfSquares, difference)
tests : Test
tests =
suite "DifferenceOfSquares"
[ suite "square the sum of the numbers up to the given number"
[ test "square of sum 5" (assertEqual 225 (squareOfSum 5))
, test "square of sum 10" (assertEqual 3025 (squareOfSum 10))
, test "square of sum 100" (assertEqual 25502500 (squareOfSum 100))
describe "DifferenceOfSquares"
[ describe "square the sum of the numbers up to the given number"
[ test "square of sum 5" <|
\() -> Expect.equal 225 (squareOfSum 5)
, test "square of sum 10" <|
\() -> Expect.equal 3025 (squareOfSum 10)
, test "square of sum 100" <|
\() -> Expect.equal 25502500 (squareOfSum 100)
]
, suite "sum the squares of the numbers up to the given number"
[ test "sum of squares 5" (assertEqual 55 (sumOfSquares 5))
, test "sum of squares 10" (assertEqual 385 (sumOfSquares 10))
, test "sum of squares 100" (assertEqual 338350 (sumOfSquares 100))
, describe "sum the squares of the numbers up to the given number"
[ test "sum of squares 5" <|
\() -> Expect.equal 55 (sumOfSquares 5)
, test "sum of squares 10" <|
\() -> Expect.equal 385 (sumOfSquares 10)
, test "sum of squares 100" <|
\() -> Expect.equal 338350 (sumOfSquares 100)
]
, suite "subtract sum of squares from square of sums"
[ test "difference of squares 0" (assertEqual 0 (difference 0))
, test "difference of squares 5" (assertEqual 170 (difference 5))
, test "difference of squares 10" (assertEqual 2640 (difference 10))
, test "difference of squares 100" (assertEqual 25164150 (difference 100))
, describe "subtract sum of squares from square of sums"
[ test "difference of squares 0" <|
\() -> Expect.equal 0 (difference 0)
, test "difference of squares 5" <|
\() -> Expect.equal 170 (difference 5)
, test "difference of squares 10" <|
\() -> Expect.equal 2640 (difference 10)
, test "difference of squares 100" <|
\() -> Expect.equal 25164150 (difference 100)
]
]
main : Program Never
main =
runSuite tests
run emit tests
port emit : ( String, Value ) -> Cmd msg

7
exercises/difference-of-squares/elm-package.json
View file

@ -1,5 +1,5 @@
{
"version": "2.0.0",
"version": "3.0.0",
"summary": "Exercism problems in Elm.",
"repository": "https://github.com/exercism/xelm.git",
"license": "BSD3",
@ -8,8 +8,9 @@
],
"exposed-modules": [],
"dependencies": {
"elm-community/elm-test": "1.0.0 <= v < 2.0.0",
"elm-lang/core": "4.0.0 <= v < 5.0.0"
"elm-lang/core": "4.0.0 <= v < 5.0.0",
"elm-community/elm-test": "2.0.0 <= v < 3.0.0",
"rtfeldman/node-test-runner": "1.0.0 <= v < 2.0.0"
},
"elm-version": "0.17.0 <= v < 0.18.0"
}

4
exercises/difference-of-squares/runtests.bat
View file

@ -1,4 +0,0 @@
@echo off
for %%f in (*Tests.elm) do (
elm-make %%f --yes --output build.js && node build.js
)

2
exercises/difference-of-squares/runtests.sh
View file

@ -1,2 +0,0 @@
#!/usr/bin/env bash
elm-make *Tests.elm --yes --output build.js && node build.js

110
exercises/grade-school/GradeSchoolTests.elm
View file

@ -1,63 +1,69 @@
module Main exposing (..)
port module Main exposing (..)
import ElmTest exposing (..)
import Test.Runner.Node exposing (run)
import Json.Encode exposing (Value)
import Test exposing (..)
import Expect
import GradeSchool exposing (addStudent, studentsInGrade, allStudents)
tests : Test
tests =
suite "GradeSchool"
[ test "add student"
(assertEqual [ "Aimee" ]
(GradeSchool.empty
|> addStudent 2 "Aimee"
|> studentsInGrade 2
)
)
, test "add more students in same class"
(assertEqual [ "Blair", "James", "Paul" ]
(GradeSchool.empty
|> addStudent 2 "James"
|> addStudent 2 "Blair"
|> addStudent 2 "Paul"
|> studentsInGrade 2
)
)
, test "add students to different grades"
(assertEqual [ [ "Chelsea" ], [ "Logan" ] ]
(let
school =
GradeSchool.empty
|> addStudent 3 "Chelsea"
|> addStudent 7 "Logan"
in
[ studentsInGrade 3 school, studentsInGrade 7 school ]
)
)
, test "get students in a grade"
(assertEqual [ "Bradley", "Franklin" ]
(GradeSchool.empty
|> addStudent 5 "Franklin"
|> addStudent 5 "Bradley"
|> addStudent 1 "Jeff"
|> studentsInGrade 5
)
)
, test "get all students in the school"
(assertEqual [ ( 3, [ "Kyle" ] ), ( 4, [ "Christopher", "Jennifer" ] ), ( 6, [ "Kareem" ] ) ]
(GradeSchool.empty
|> addStudent 4 "Jennifer"
|> addStudent 6 "Kareem"
|> addStudent 4 "Christopher"
|> addStudent 3 "Kyle"
|> allStudents
)
)
, test "get students in a non-existent grade"
(assertEqual [] (studentsInGrade 1 GradeSchool.empty))
describe "GradeSchool"
[ test "add student" <|
\() ->
Expect.equal [ "Aimee" ]
(GradeSchool.empty
|> addStudent 2 "Aimee"
|> studentsInGrade 2
)
, test "add more students in same class" <|
\() ->
Expect.equal [ "Blair", "James", "Paul" ]
(GradeSchool.empty
|> addStudent 2 "James"
|> addStudent 2 "Blair"
|> addStudent 2 "Paul"
|> studentsInGrade 2
)
, test "add students to different grades" <|
\() ->
Expect.equal [ [ "Chelsea" ], [ "Logan" ] ]
(let
school =
GradeSchool.empty
|> addStudent 3 "Chelsea"
|> addStudent 7 "Logan"
in
[ studentsInGrade 3 school, studentsInGrade 7 school ]
)
, test "get students in a grade" <|
\() ->
Expect.equal [ "Bradley", "Franklin" ]
(GradeSchool.empty
|> addStudent 5 "Franklin"
|> addStudent 5 "Bradley"
|> addStudent 1 "Jeff"
|> studentsInGrade 5
)
, test "get all students in the school" <|
\() ->
Expect.equal [ ( 3, [ "Kyle" ] ), ( 4, [ "Christopher", "Jennifer" ] ), ( 6, [ "Kareem" ] ) ]
(GradeSchool.empty
|> addStudent 4 "Jennifer"
|> addStudent 6 "Kareem"
|> addStudent 4 "Christopher"
|> addStudent 3 "Kyle"
|> allStudents
)
, test "get students in a non-existent grade" <|
\() -> Expect.equal [] (studentsInGrade 1 GradeSchool.empty)
]
main : Program Never
main =
runSuite tests
run emit tests
port emit : ( String, Value ) -> Cmd msg

7
exercises/grade-school/elm-package.json
View file

@ -1,5 +1,5 @@
{
"version": "2.0.0",
"version": "3.0.0",
"summary": "Exercism problems in Elm.",
"repository": "https://github.com/exercism/xelm.git",
"license": "BSD3",
@ -8,8 +8,9 @@
],
"exposed-modules": [],
"dependencies": {
"elm-community/elm-test": "1.0.0 <= v < 2.0.0",
"elm-lang/core": "4.0.0 <= v < 5.0.0"
"elm-lang/core": "4.0.0 <= v < 5.0.0",
"elm-community/elm-test": "2.0.0 <= v < 3.0.0",
"rtfeldman/node-test-runner": "1.0.0 <= v < 2.0.0"
},
"elm-version": "0.17.0 <= v < 0.18.0"
}

4
exercises/grade-school/runtests.bat
View file

@ -1,4 +0,0 @@
@echo off
for %%f in (*Tests.elm) do (
elm-make %%f --yes --output build.js && node build.js
)

2
exercises/grade-school/runtests.sh
View file

@ -1,2 +0,0 @@
#!/usr/bin/env bash
elm-make *Tests.elm --yes --output build.js && node build.js

70
exercises/hamming/HammingTests.elm
View file

@ -1,43 +1,49 @@
module Main exposing (..)
port module Main exposing (..)
import ElmTest exposing (..)
import Test.Runner.Node exposing (run)
import Json.Encode exposing (Value)
import Test exposing (..)
import Expect
import Hamming exposing (distance)
tests : Test
tests =
suite "Hamming"
[ test "identical strands"
(assertEqual (Just 0) (distance "A" "A"))
, test "long identical strands"
(assertEqual (Just 0) (distance "GGACTGA" "GGACTGA"))
, test "complete distance in single nucleotide strands"
(assertEqual (Just 1) (distance "A" "G"))
, test "complete distance in small strands"
(assertEqual (Just 2) (distance "AG" "CT"))
, test "small distance in small strands"
(assertEqual (Just 1) (distance "AT" "CT"))
, test "small distance"
(assertEqual (Just 1) (distance "GGACG" "GGTCG"))
, test "small distance in long strands"
(assertEqual (Just 2) (distance "ACCAGGG" "ACTATGG"))
, test "non-unique character in first strand"
(assertEqual (Just 1) (distance "AGA" "AGG"))
, test "non-unique character in second strand"
(assertEqual (Just 1) (distance "AGG" "AGA"))
, test "large distance"
(assertEqual (Just 4) (distance "GATACA" "GCATAA"))
, test "large distance in off-by-one strand"
(assertEqual (Just 9) (distance "GGACGGATTCTG" "AGGACGGATTCT"))
, test "empty strands"
(assertEqual (Just 0) (distance "" ""))
, test "disallow first strand longer"
(assertEqual Nothing (distance "AATG" "AAA"))
, test "disallow second strand longer"
(assertEqual Nothing (distance "ATA" "AGTG"))
describe "Hamming"
[ test "identical strands" <|
\() -> Expect.equal (Just 0) (distance "A" "A")
, test "long identical strands" <|
\() -> Expect.equal (Just 0) (distance "GGACTGA" "GGACTGA")
, test "complete distance in single nucleotide strands" <|
\() -> Expect.equal (Just 1) (distance "A" "G")
, test "complete distance in small strands" <|
\() -> Expect.equal (Just 2) (distance "AG" "CT")
, test "small distance in small strands" <|
\() -> Expect.equal (Just 1) (distance "AT" "CT")
, test "small distance" <|
\() -> Expect.equal (Just 1) (distance "GGACG" "GGTCG")
, test "small distance in long strands" <|
\() -> Expect.equal (Just 2) (distance "ACCAGGG" "ACTATGG")
, test "non-unique character in first strand" <|
\() -> Expect.equal (Just 1) (distance "AGA" "AGG")
, test "non-unique character in second strand" <|
\() -> Expect.equal (Just 1) (distance "AGG" "AGA")
, test "large distance" <|
\() -> Expect.equal (Just 4) (distance "GATACA" "GCATAA")
, test "large distance in off-by-one strand" <|
\() -> Expect.equal (Just 9) (distance "GGACGGATTCTG" "AGGACGGATTCT")
, test "empty strands" <|
\() -> Expect.equal (Just 0) (distance "" "")
, test "disallow first strand longer" <|
\() -> Expect.equal Nothing (distance "AATG" "AAA")
, test "disallow second strand longer" <|
\() -> Expect.equal Nothing (distance "ATA" "AGTG")
]
main : Program Never
main =
runSuite tests
run emit tests
port emit : ( String, Value ) -> Cmd msg

7
exercises/hamming/elm-package.json
View file

@ -1,5 +1,5 @@
{
"version": "2.0.0",
"version": "3.0.0",
"summary": "Exercism problems in Elm.",
"repository": "https://github.com/exercism/xelm.git",
"license": "BSD3",
@ -8,8 +8,9 @@
],
"exposed-modules": [],
"dependencies": {
"elm-community/elm-test": "1.0.0 <= v < 2.0.0",
"elm-lang/core": "4.0.0 <= v < 5.0.0"
"elm-lang/core": "4.0.0 <= v < 5.0.0",
"elm-community/elm-test": "2.0.0 <= v < 3.0.0",
"rtfeldman/node-test-runner": "1.0.0 <= v < 2.0.0"
},
"elm-version": "0.17.0 <= v < 0.18.0"
}

4
exercises/hamming/runtests.bat
View file

@ -1,4 +0,0 @@
@echo off
for %%f in (*Tests.elm) do (
elm-make %%f --yes --output build.js && node build.js
)

2
exercises/hamming/runtests.sh
View file

@ -1,2 +0,0 @@
#!/usr/bin/env bash
elm-make *Tests.elm --yes --output build.js && node build.js

26
exercises/hello-world/HelloWorldTests.elm
View file

@ -1,18 +1,30 @@
module Main exposing (..)
port module Main exposing (..)
import ElmTest exposing (..)
import Test.Runner.Node exposing (run)
import Json.Encode exposing (Value)
import Test exposing (..)
import Expect
import HelloWorld exposing (helloWorld)
tests : Test
tests =
suite "Hello, World!"
[ test "Hello with no name" (assertEqual "Hello, World!" (helloWorld Nothing))
, test "Hello to a sample name" (assertEqual "Hello, Alice!" (helloWorld (Just "Alice")))
, test "Hello to another sample name" (assertEqual "Hello, Bob!" (helloWorld (Just "Bob")))
describe "Hello, World!"
[ test "Hello with no name" <|
\() ->
Expect.equal "Hello, World!" (helloWorld Nothing)
, test "Hello to a sample name" <|
\() ->
Expect.equal "Hello, Alice!" (helloWorld (Just "Alice"))
, test "Hello to another sample name" <|
\() ->
Expect.equal "Hello, Bob!" (helloWorld (Just "Bob"))
]
main : Program Never
main =
runSuite tests
run emit tests
port emit : ( String, Value ) -> Cmd msg

7
exercises/hello-world/elm-package.json
View file

@ -1,5 +1,5 @@
{
"version": "2.0.0",
"version": "3.0.0",
"summary": "Exercism problems in Elm.",
"repository": "https://github.com/exercism/xelm.git",
"license": "BSD3",
@ -8,8 +8,9 @@
],
"exposed-modules": [],
"dependencies": {
"elm-community/elm-test": "1.0.0 <= v < 2.0.0",
"elm-lang/core": "4.0.0 <= v < 5.0.0"
"elm-lang/core": "4.0.0 <= v < 5.0.0",
"elm-community/elm-test": "2.0.0 <= v < 3.0.0",
"rtfeldman/node-test-runner": "1.0.0 <= v < 2.0.0"
},
"elm-version": "0.17.0 <= v < 0.18.0"
}

4
exercises/hello-world/runtests.bat
View file

@ -1,4 +0,0 @@
@echo off
for %%f in (*Tests.elm) do (
elm-make %%f --yes --output build.js && node build.js
)

2
exercises/hello-world/runtests.sh
View file

@ -1,2 +0,0 @@
#!/usr/bin/env bash
elm-make *Tests.elm --yes --output build.js && node build.js

82
exercises/largest-series-product/LargestSeriesProductTests.elm
View file

@ -1,49 +1,55 @@
module Main exposing (..)
port module Main exposing (..)
import ElmTest exposing (..)
import Test.Runner.Node exposing (run)
import Json.Encode exposing (Value)
import Test exposing (..)
import Expect
import LargestSeriesProduct exposing (largestProduct)
tests : Test
tests =
suite "largestProduct"
[ test "can find the largest product of 2 with numbers in order"
(assertEqual (Just 72) (largestProduct 2 "0123456789"))
, test "can find the largest product of 2"
(assertEqual (Just 48) (largestProduct 2 "576802143"))
, test "finds the largest product if span equals length"
(assertEqual (Just 18) (largestProduct 2 "29"))
, test "can find the largest product of 3 with numbers in order"
(assertEqual (Just 504) (largestProduct 3 "0123456789"))
, test "can find the largest product of 3"
(assertEqual (Just 270) (largestProduct 3 "1027839564"))
, test "can find the largest product of 5 with numbers in order"
(assertEqual (Just 15120) (largestProduct 5 "0123456789"))
, test "can get the largest product of a big number"
(assertEqual (Just 23520) (largestProduct 6 "73167176531330624919225119674426574742355349194934"))
, test "can get the largest product of a big number II"
(assertEqual (Just 28350) (largestProduct 6 "52677741234314237566414902593461595376319419139427"))
, test "can get the largest product of a big number (Project Euler)"
(assertEqual (Just 23514624000) (largestProduct 13 "7316717653133062491922511967442657474235534919493496983520312774506326239578318016984801869478851843858615607891129494954595017379583319528532088055111254069874715852386305071569329096329522744304355766896648950445244523161731856403098711121722383113622298934233803081353362766142828064444866452387493035890729629049156044077239071381051585930796086670172427121883998797908792274921901699720888093776657273330010533678812202354218097512545405947522435258490771167055601360483958644670632441572215539753697817977846174064955149290862569321978468622482839722413756570560574902614079729686524145351004748216637048440319989000889524345065854122758866688116427171479924442928230863465674813919123162824586178664583591245665294765456828489128831426076900422421902267105562632111110937054421750694165896040807198403850962455444362981230987879927244284909188845801561660979191338754992005240636899125607176060588611646710940507754100225698315520005593572972571636269561882670428252483600823257530420752963450"))
, test "reports zero if the only digits are zero"
(assertEqual (Just 0) (largestProduct 2 "0000"))
, test "reports zero if all spans include zero"
(assertEqual (Just 0) (largestProduct 3 "99099"))
, test "rejects span longer than string length"
(assertEqual Nothing (largestProduct 4 "123"))
, test "reports 1 for empty string and empty product (0 span)"
(assertEqual (Just 1) (largestProduct 0 ""))
, test "reports 1 for nonempty string and empty product (0 span)"
(assertEqual (Just 1) (largestProduct 0 "123"))
, test "rejects empty string and nonzero span"
(assertEqual Nothing (largestProduct 1 ""))
, test "rejects invalid character in digits"
(assertEqual Nothing (largestProduct 2 "1234a5"))
, test "rejects negative span"
(assertEqual Nothing (largestProduct -1 "12345"))
describe "largestProduct"
[ test "can find the largest product of 2 with numbers in order" <|
\() -> Expect.equal (Just 72) (largestProduct 2 "0123456789")
, test "can find the largest product of 2" <|
\() -> Expect.equal (Just 48) (largestProduct 2 "576802143")
, test "finds the largest product if span equals length" <|
\() -> Expect.equal (Just 18) (largestProduct 2 "29")
, test "can find the largest product of 3 with numbers in order" <|
\() -> Expect.equal (Just 504) (largestProduct 3 "0123456789")
, test "can find the largest product of 3" <|
\() -> Expect.equal (Just 270) (largestProduct 3 "1027839564")
, test "can find the largest product of 5 with numbers in order" <|
\() -> Expect.equal (Just 15120) (largestProduct 5 "0123456789")
, test "can get the largest product of a big number" <|
\() -> Expect.equal (Just 23520) (largestProduct 6 "73167176531330624919225119674426574742355349194934")
, test "can get the largest product of a big number II" <|
\() -> Expect.equal (Just 28350) (largestProduct 6 "52677741234314237566414902593461595376319419139427")
, test "can get the largest product of a big number (Project Euler)" <|
\() -> Expect.equal (Just 23514624000) (largestProduct 13 "7316717653133062491922511967442657474235534919493496983520312774506326239578318016984801869478851843858615607891129494954595017379583319528532088055111254069874715852386305071569329096329522744304355766896648950445244523161731856403098711121722383113622298934233803081353362766142828064444866452387493035890729629049156044077239071381051585930796086670172427121883998797908792274921901699720888093776657273330010533678812202354218097512545405947522435258490771167055601360483958644670632441572215539753697817977846174064955149290862569321978468622482839722413756570560574902614079729686524145351004748216637048440319989000889524345065854122758866688116427171479924442928230863465674813919123162824586178664583591245665294765456828489128831426076900422421902267105562632111110937054421750694165896040807198403850962455444362981230987879927244284909188845801561660979191338754992005240636899125607176060588611646710940507754100225698315520005593572972571636269561882670428252483600823257530420752963450")
, test "reports zero if the only digits are zero" <|
\() -> Expect.equal (Just 0) (largestProduct 2 "0000")
, test "reports zero if all spans include zero" <|
\() -> Expect.equal (Just 0) (largestProduct 3 "99099")
, test "rejects span longer than string length" <|
\() -> Expect.equal Nothing (largestProduct 4 "123")
, test "reports 1 for empty string and empty product (0 span)" <|
\() -> Expect.equal (Just 1) (largestProduct 0 "")
, test "reports 1 for nonempty string and empty product (0 span)" <|
\() -> Expect.equal (Just 1) (largestProduct 0 "123")
, test "rejects empty string and nonzero span" <|
\() -> Expect.equal Nothing (largestProduct 1 "")
, test "rejects invalid character in digits" <|
\() -> Expect.equal Nothing (largestProduct 2 "1234a5")
, test "rejects negative span" <|
\() -> Expect.equal Nothing (largestProduct -1 "12345")
]
main : Program Never
main =
runSuite tests
run emit tests
port emit : ( String, Value ) -> Cmd msg

7
exercises/largest-series-product/elm-package.json
View file

@ -1,5 +1,5 @@
{
"version": "2.0.0",
"version": "3.0.0",
"summary": "Exercism problems in Elm.",
"repository": "https://github.com/exercism/xelm.git",
"license": "BSD3",
@ -8,8 +8,9 @@
],
"exposed-modules": [],
"dependencies": {
"elm-community/elm-test": "1.0.0 <= v < 2.0.0",
"elm-lang/core": "4.0.0 <= v < 5.0.0"
"elm-lang/core": "4.0.0 <= v < 5.0.0",
"elm-community/elm-test": "2.0.0 <= v < 3.0.0",
"rtfeldman/node-test-runner": "1.0.0 <= v < 2.0.0"
},
"elm-version": "0.17.0 <= v < 0.18.0"
}

4
exercises/largest-series-product/runtests.bat
View file

@ -1,4 +0,0 @@
@echo off
for %%f in (*Tests.elm) do (
elm-make %%f --yes --output build.js && node build.js
)

2
exercises/largest-series-product/runtests.sh
View file

@ -1,2 +0,0 @@
#!/usr/bin/env bash
elm-make *Tests.elm --yes --output build.js && node build.js

35
exercises/leap/LeapTests.elm
View file

@ -1,22 +1,35 @@
module Main exposing (..)
port module Main exposing (..)
import ElmTest exposing (..)
import Test.Runner.Node exposing (run)
import Json.Encode exposing (Value)
import Test exposing (..)
import Expect
import Leap
tests : Test
tests =
suite "Leap"
[ test "leap year" (assertEqual True (Leap.isLeapYear 1996))
, test "non-leap year" (assertEqual False (Leap.isLeapYear 1997))
, test "non-leap even year" (assertEqual False (Leap.isLeapYear 1998))
, test "century" (assertEqual False (Leap.isLeapYear 1900))
, test "second century" (assertEqual False (Leap.isLeapYear 1800))
, test "fourth century" (assertEqual True (Leap.isLeapYear 2400))
, test "y2k" (assertEqual True (Leap.isLeapYear 2000))
describe "Leap"
[ test "leap year" <|
\() -> Expect.equal True (Leap.isLeapYear 1996)
, test "non-leap year" <|
\() -> Expect.equal False (Leap.isLeapYear 1997)
, test "non-leap even year" <|
\() -> Expect.equal False (Leap.isLeapYear 1998)
, test "century" <|
\() -> Expect.equal False (Leap.isLeapYear 1900)
, test "second century" <|
\() -> Expect.equal False (Leap.isLeapYear 1800)
, test "fourth century" <|
\() -> Expect.equal True (Leap.isLeapYear 2400)
, test "y2k" <|
\() -> Expect.equal True (Leap.isLeapYear 2000)
]
main : Program Never
main =
runSuite tests
run emit tests
port emit : ( String, Value ) -> Cmd msg

7
exercises/leap/elm-package.json
View file

@ -1,5 +1,5 @@
{
"version": "2.0.0",
"version": "3.0.0",
"summary": "Exercism problems in Elm.",
"repository": "https://github.com/exercism/xelm.git",
"license": "BSD3",
@ -8,8 +8,9 @@
],
"exposed-modules": [],
"dependencies": {
"elm-community/elm-test": "1.0.0 <= v < 2.0.0",
"elm-lang/core": "4.0.0 <= v < 5.0.0"
"elm-lang/core": "4.0.0 <= v < 5.0.0",
"elm-community/elm-test": "2.0.0 <= v < 3.0.0",
"rtfeldman/node-test-runner": "1.0.0 <= v < 2.0.0"
},
"elm-version": "0.17.0 <= v < 0.18.0"
}

4
exercises/leap/runtests.bat
View file

@ -1,4 +0,0 @@
@echo off
for %%f in (*Tests.elm) do (
elm-make %%f --yes --output build.js && node build.js
)

2
exercises/leap/runtests.sh
View file

@ -1,2 +0,0 @@
#!/usr/bin/env bash
elm-make *Tests.elm --yes --output build.js && node build.js

94
exercises/list-ops/ListOpsTests.elm
View file

@ -1,55 +1,77 @@
module Main exposing (..)
port module Main exposing (..)
import ElmTest exposing (..)
import Test.Runner.Node exposing (run)
import Json.Encode exposing (Value)
import Test exposing (..)
import Expect
import ListOps exposing (..)
tests : Test
tests =
suite "List Ops"
[ suite "length"
[ test "empty list" (assertEqual 0 (length []))
, test "non-empty list" (assertEqual 4 (length [1..4]))
describe "List Ops"
[ describe "length"
[ test "empty list" <|
\() -> Expect.equal 0 (ListOps.length [])
, test "non-empty list" <|
\() -> Expect.equal 4 (ListOps.length [1..4])
]
, suite "reverse"
[ test "empty list" (assertEqual [] (reverse []))
, test "non-empty list" (assertEqual [ 4, 3, 2, 1 ] (reverse [1..4]))
, describe "reverse"
[ test "empty list" <|
\() -> Expect.equal [] (ListOps.reverse [])
, test "non-empty list" <|
\() -> Expect.equal [ 4, 3, 2, 1 ] (ListOps.reverse [1..4])
]
, suite "map"
[ test "empty list" (assertEqual [] (map ((+) 1) []))
, test "non-empty list" (assertEqual [2..5] (map ((+) 1) [1..4]))
, describe "map"
[ test "empty list" <|
\() -> Expect.equal [] (ListOps.map ((+) 1) [])
, test "non-empty list" <|
\() -> Expect.equal [2..5] (ListOps.map ((+) 1) [1..4])
]
, suite "filter"
[ test "empty list" (assertEqual [] (filter (\_ -> True) []))
, test "non-empty list"
(assertEqual [ 2, 4 ] (filter (\x -> x % 2 == 0) [1..4]))
, describe "filter"
[ test "empty list" <|
\() -> Expect.equal [] (ListOps.filter (\_ -> True) [])
, test "non-empty list" <|
\() -> Expect.equal [ 2, 4 ] (ListOps.filter (\x -> x % 2 == 0) [1..4])
]
, suite "foldl"
[ test "empty list" (assertEqual 0 (foldl (+) 0 []))
, test "non-empty list" (assertEqual 10 (foldl (+) 0 [1..4]))
, test "direction" (assertEqual [4,3,2,1] (foldl (::) [] [1..4]))
, describe "foldl"
[ test "empty list" <|
\() -> Expect.equal 0 (ListOps.foldl (+) 0 [])
, test "non-empty list" <|
\() -> Expect.equal 10 (ListOps.foldl (+) 0 [1..4])
, test "direction" <|
\() -> Expect.equal [ 4, 3, 2, 1 ] (ListOps.foldl (::) [] [1..4])
]
, suite "foldr"
[ test "empty list" (assertEqual 0 (foldr (+) 0 []))
, test "non-empty list" (assertEqual 10 (foldr (+) 0 [1..4]))
, test "direction" (assertEqual [1..4] (foldr (::) [] [1..4]))
, describe "foldr"
[ test "empty list" <|
\() -> Expect.equal 0 (ListOps.foldr (+) 0 [])
, test "non-empty list" <|
\() -> Expect.equal 10 (ListOps.foldr (+) 0 [1..4])
, test "direction" <|
\() -> Expect.equal [1..4] (ListOps.foldr (::) [] [1..4])
]
, suite "append"
[ test "empty lists" (assertEqual [] (append [] []))
, test "empty and non-empty lists"
(assertEqual [1..4] (append [] [1..4]))
, test "non-empty and empty lists"
(assertEqual [1..4] (append [1..4] []))
, test "non-empty lists" (assertEqual [1..8] (append [1..4] [5..8]))
, describe "append"
[ test "empty lists" <|
\() -> Expect.equal [] (ListOps.append [] [])
, test "empty and non-empty lists" <|
\() -> Expect.equal [1..4] (ListOps.append [] [1..4])
, test "non-empty and empty lists" <|
\() -> Expect.equal [1..4] (ListOps.append [1..4] [])
, test "non-empty lists" <|
\() -> Expect.equal [1..8] (ListOps.append [1..4] [5..8])
]
, suite "concat"
[ test "empty list" (assertEqual [] (concat []))
, test "list of lists"
(assertEqual [1..10] (concat [ [1..3], [], [4..7], [8..10] ]))
, describe "concat"
[ test "empty list" <|
\() -> Expect.equal [] (ListOps.concat [])
, test "list of lists" <|
\() -> Expect.equal [1..10] (ListOps.concat [ [1..3], [], [4..7], [8..10] ])
]
]
main : Program Never
main =
runSuite tests
run emit tests
port emit : ( String, Value ) -> Cmd msg

7
exercises/list-ops/elm-package.json
View file

@ -1,5 +1,5 @@
{
"version": "2.0.0",
"version": "3.0.0",
"summary": "Exercism problems in Elm.",
"repository": "https://github.com/exercism/xelm.git",
"license": "BSD3",
@ -8,8 +8,9 @@
],
"exposed-modules": [],
"dependencies": {
"elm-community/elm-test": "1.0.0 <= v < 2.0.0",
"elm-lang/core": "4.0.0 <= v < 5.0.0"
"elm-lang/core": "4.0.0 <= v < 5.0.0",
"elm-community/elm-test": "2.0.0 <= v < 3.0.0",
"rtfeldman/node-test-runner": "1.0.0 <= v < 2.0.0"
},
"elm-version": "0.17.0 <= v < 0.18.0"
}

4
exercises/list-ops/runtests.bat
View file

@ -1,4 +0,0 @@
@echo off
for %%f in (*Tests.elm) do (
elm-make %%f --yes --output build.js && node build.js
)

2
exercises/list-ops/runtests.sh
View file

@ -1,2 +0,0 @@
#!/usr/bin/env bash
elm-make *Tests.elm --yes --output build.js && node build.js

42
exercises/nucleotide-count/NucleotideCountTests.elm
View file

@ -1,29 +1,35 @@
module Main exposing (..)
port module Main exposing (..)
import ElmTest exposing (..)
import Test.Runner.Node exposing (run)
import Json.Encode exposing (Value)
import Test exposing (..)
import Expect
import NucleotideCount exposing (nucleotideCounts, version)
tests : Test
tests =
suite "NucleotideCount"
[ test "the solution is for the correct version of the test"
(assertEqual 2 version)
, test "empty dna strand has no nucleotides"
(assertEqual { a = 0, t = 0, c = 0, g = 0 }
(nucleotideCounts "")
)
, test "repetitive-sequence-has-only-guanosine"
(assertEqual { a = 0, t = 0, c = 0, g = 8 }
(nucleotideCounts "GGGGGGGG")
)
, test "counts all nucleotides"
(assertEqual { a = 20, t = 21, c = 12, g = 17 }
(nucleotideCounts "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC")
)
describe "NucleotideCount"
[ test "the solution is for the correct version of the test" <|
\() -> Expect.equal 2 version
, test "empty dna strand has no nucleotides" <|
\() ->
Expect.equal { a = 0, t = 0, c = 0, g = 0 }
(nucleotideCounts "")
, test "repetitive-sequence-has-only-guanosine" <|
\() ->
Expect.equal { a = 0, t = 0, c = 0, g = 8 }
(nucleotideCounts "GGGGGGGG")
, test "counts all nucleotides" <|
\() ->
Expect.equal { a = 20, t = 21, c = 12, g = 17 }
(nucleotideCounts "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC")
]
main : Program Never
main =
runSuite tests
run emit tests
port emit : ( String, Value ) -> Cmd msg

7
exercises/nucleotide-count/elm-package.json
View file

@ -1,5 +1,5 @@
{
"version": "2.0.0",
"version": "3.0.0",
"summary": "Exercism problems in Elm.",
"repository": "https://github.com/exercism/xelm.git",
"license": "BSD3",
@ -8,8 +8,9 @@
],
"exposed-modules": [],
"dependencies": {
"elm-community/elm-test": "1.0.0 <= v < 2.0.0",
"elm-lang/core": "4.0.0 <= v < 5.0.0"
"elm-lang/core": "4.0.0 <= v < 5.0.0",
"elm-community/elm-test": "2.0.0 <= v < 3.0.0",
"rtfeldman/node-test-runner": "1.0.0 <= v < 2.0.0"
},
"elm-version": "0.17.0 <= v < 0.18.0"
}

4
exercises/nucleotide-count/runtests.bat
View file

@ -1,4 +0,0 @@
@echo off
for %%f in (*Tests.elm) do (
elm-make %%f --yes --output build.js && node build.js
)

2
exercises/nucleotide-count/runtests.sh
View file

@ -1,2 +0,0 @@
#!/usr/bin/env bash
elm-make *Tests.elm --yes --output build.js && node build.js

86
exercises/pangram/PangramTests.elm
View file

@ -1,51 +1,57 @@
module Main exposing (..)
port module Main exposing (..)
import ElmTest exposing (..)
import Test.Runner.Node exposing (run)
import Json.Encode exposing (Value)
import Test exposing (..)
import Expect
import Pangram exposing (isPangram)
tests : Test
tests =
suite "Pangram"
[ test "sentence empty"
(assertEqual False
(isPangram "")
)
, test "pangram with only lower case"
(assertEqual True
(isPangram "the quick brown fox jumps over the lazy dog")
)
, test "missing character 'x'"
(assertEqual False
(isPangram "a quick movement of the enemy will jeopardize five gunboats")
)
, test "another missing character 'x'"
(assertEqual False
(isPangram "the quick brown fish jumps over the lazy dog")
)
, test "pangram with underscores"
(assertEqual True
(isPangram "the_quick_brown_fox_jumps_over_the_lazy_dog")
)
, test "pangram with numbers"
(assertEqual True
(isPangram "the 1 quick brown fox jumps over the 2 lazy dogs")
)
, test "missing letters replaced by numbers"
(assertEqual False
(isPangram "7h3 qu1ck brown fox jumps ov3r 7h3 lazy dog")
)
, test "pangram with mixed case and punctuation"
(assertEqual True
(isPangram "\"Five quacking Zephyrs jolt my wax bed.\"")
)
, test "pangram with non ascii characters"
(assertEqual True
(isPangram "Victor jagt zwölf Boxkämpfer quer über den großen Sylter Deich.")
)
describe "Pangram"
[ test "sentence empty" <|
\() ->
Expect.equal False
(isPangram "")
, test "pangram with only lower case" <|
\() ->
Expect.equal True
(isPangram "the quick brown fox jumps over the lazy dog")
, test "missing character 'x'" <|
\() ->
Expect.equal False
(isPangram "a quick movement of the enemy will jeopardize five gunboats")
, test "another missing character 'x'" <|
\() ->
Expect.equal False
(isPangram "the quick brown fish jumps over the lazy dog")
, test "pangram with underscores" <|
\() ->
Expect.equal True
(isPangram "the_quick_brown_fox_jumps_over_the_lazy_dog")
, test "pangram with numbers" <|
\() ->
Expect.equal True
(isPangram "the 1 quick brown fox jumps over the 2 lazy dogs")
, test "missing letters replaced by numbers" <|
\() ->
Expect.equal False
(isPangram "7h3 qu1ck brown fox jumps ov3r 7h3 lazy dog")
, test "pangram with mixed case and punctuation" <|
\() ->
Expect.equal True
(isPangram "\"Five quacking Zephyrs jolt my wax bed.\"")
, test "pangram with non ascii characters" <|
\() ->
Expect.equal True
(isPangram "Victor jagt zwölf Boxkämpfer quer über den großen Sylter Deich.")
]
main : Program Never
main =
runSuite tests
run emit tests
port emit : ( String, Value ) -> Cmd msg

7
exercises/pangram/elm-package.json
View file

@ -1,5 +1,5 @@
{
"version": "2.0.0",
"version": "3.0.0",
"summary": "Exercism problems in Elm.",
"repository": "https://github.com/exercism/xelm.git",
"license": "BSD3",
@ -8,8 +8,9 @@
],
"exposed-modules": [],
"dependencies": {
"elm-community/elm-test": "1.0.0 <= v < 2.0.0",
"elm-lang/core": "4.0.0 <= v < 5.0.0"
"elm-lang/core": "4.0.0 <= v < 5.0.0",
"elm-community/elm-test": "2.0.0 <= v < 3.0.0",
"rtfeldman/node-test-runner": "1.0.0 <= v < 2.0.0"
},
"elm-version": "0.17.0 <= v < 0.18.0"
}

4
exercises/pangram/runtests.bat
View file

@ -1,4 +0,0 @@
@echo off
for %%f in (*Tests.elm) do (
elm-make %%f --yes --output build.js && node build.js
)

2
exercises/pangram/runtests.sh
View file

@ -1,2 +0,0 @@
#!/usr/bin/env bash
elm-make *Tests.elm --yes --output build.js && node build.js

62
exercises/phone-number/PhoneNumberTests.elm
View file

@ -1,39 +1,45 @@
module Main exposing (..)
port module Main exposing (..)
import ElmTest exposing (..)
import Test.Runner.Node exposing (run)
import Json.Encode exposing (Value)
import Test exposing (..)
import Expect
import PhoneNumber exposing (getNumber, prettyPrint)
tests : Test
tests =
suite "PhoneNumber"
[ test "cleans number"
(assertEqual (Just "1234567890") (getNumber "(123) 456-7890"))
, test "cleans number with dots"
(assertEqual (Just "1234567890") (getNumber "123.456.7890"))
, test "valid when 11 digits and first is 1"
(assertEqual (Just "1234567890") (getNumber "11234567890"))
, test "invalid when 11 digits"
(assertEqual Nothing (getNumber "21234567890"))
, test "invalid when 9 digits"
(assertEqual Nothing (getNumber "123456789"))
, test "invalid when 12 digits"
(assertEqual Nothing (getNumber "123456789012"))
, test "invalid when empty"
(assertEqual Nothing (getNumber ""))
, test "invalid when no digits present"
(assertEqual Nothing (getNumber " (-) "))
, test "valid with leading characters"
(assertEqual (Just "1234567890") (getNumber "my number is 123 456 7890"))
, test "valid with trailing characters"
(assertEqual (Just "1234567890") (getNumber "123 456 7890 - bob"))
, test "pretty print"
(assertEqual (Just "(123) 456-7890") (prettyPrint "1234567890"))
, test "pretty print with full us phone number"
(assertEqual (Just "(123) 456-7890") (prettyPrint "11234567890"))
describe "PhoneNumber"
[ test "cleans number" <|
\() -> Expect.equal (Just "1234567890") (getNumber "(123) 456-7890")
, test "cleans number with dots" <|
\() -> Expect.equal (Just "1234567890") (getNumber "123.456.7890")
, test "valid when 11 digits and first is 1" <|
\() -> Expect.equal (Just "1234567890") (getNumber "11234567890")
, test "invalid when 11 digits" <|
\() -> Expect.equal Nothing (getNumber "21234567890")
, test "invalid when 9 digits" <|
\() -> Expect.equal Nothing (getNumber "123456789")
, test "invalid when 12 digits" <|
\() -> Expect.equal Nothing (getNumber "123456789012")
, test "invalid when empty" <|
\() -> Expect.equal Nothing (getNumber "")
, test "invalid when no digits present" <|
\() -> Expect.equal Nothing (getNumber " (-) ")
, test "valid with leading characters" <|
\() -> Expect.equal (Just "1234567890") (getNumber "my number is 123 456 7890")
, test "valid with trailing characters" <|
\() -> Expect.equal (Just "1234567890") (getNumber "123 456 7890 - bob")
, test "pretty print" <|
\() -> Expect.equal (Just "(123) 456-7890") (prettyPrint "1234567890")
, test "pretty print with full us phone number" <|
\() -> Expect.equal (Just "(123) 456-7890") (prettyPrint "11234567890")
]
main : Program Never
main =
runSuite tests
run emit tests
port emit : ( String, Value ) -> Cmd msg

7
exercises/phone-number/elm-package.json
View file

@ -1,5 +1,5 @@
{
"version": "2.0.0",
"version": "3.0.0",
"summary": "Exercism problems in Elm.",
"repository": "https://github.com/exercism/xelm.git",
"license": "BSD3",
@ -8,8 +8,9 @@
],
"exposed-modules": [],
"dependencies": {
"elm-community/elm-test": "1.0.0 <= v < 2.0.0",
"elm-lang/core": "4.0.0 <= v < 5.0.0"
"elm-lang/core": "4.0.0 <= v < 5.0.0",
"elm-community/elm-test": "2.0.0 <= v < 3.0.0",
"rtfeldman/node-test-runner": "1.0.0 <= v < 2.0.0"
},
"elm-version": "0.17.0 <= v < 0.18.0"
}

4
exercises/phone-number/runtests.bat
View file

@ -1,4 +0,0 @@
@echo off
for %%f in (*Tests.elm) do (
elm-make %%f --yes --output build.js && node build.js
)

2
exercises/phone-number/runtests.sh
View file

@ -1,2 +0,0 @@
#!/usr/bin/env bash
elm-make *Tests.elm --yes --output build.js && node build.js

59
exercises/raindrops/RaindropsTests.elm
View file

@ -1,30 +1,51 @@
module Main exposing (..)
port module Main exposing (..)
import ElmTest exposing (..)
import Test.Runner.Node exposing (run)
import Json.Encode exposing (Value)
import Test exposing (..)
import Expect
import Raindrops exposing (raindrops)
tests : Test
tests =
suite "Raindrops"
[ test "1" (assertEqual "1" (raindrops 1))
, test "3" (assertEqual "Pling" (raindrops 3))
, test "5" (assertEqual "Plang" (raindrops 5))
, test "7" (assertEqual "Plong" (raindrops 7))
, test "6" (assertEqual "Pling" (raindrops 6))
, test "9" (assertEqual "Pling" (raindrops 9))
, test "10" (assertEqual "Plang" (raindrops 10))
, test "14" (assertEqual "Plong" (raindrops 14))
, test "15" (assertEqual "PlingPlang" (raindrops 15))
, test "21" (assertEqual "PlingPlong" (raindrops 21))
, test "25" (assertEqual "Plang" (raindrops 25))
, test "35" (assertEqual "PlangPlong" (raindrops 35))
, test "49" (assertEqual "Plong" (raindrops 49))
, test "52" (assertEqual "52" (raindrops 52))
, test "105" (assertEqual "PlingPlangPlong" (raindrops 105))
describe "Raindrops"
[ test "1" <|
\() -> Expect.equal "1" (raindrops 1)
, test "3" <|
\() -> Expect.equal "Pling" (raindrops 3)
, test "5" <|
\() -> Expect.equal "Plang" (raindrops 5)
, test "7" <|
\() -> Expect.equal "Plong" (raindrops 7)
, test "6" <|
\() -> Expect.equal "Pling" (raindrops 6)
, test "9" <|
\() -> Expect.equal "Pling" (raindrops 9)
, test "10" <|
\() -> Expect.equal "Plang" (raindrops 10)
, test "14" <|
\() -> Expect.equal "Plong" (raindrops 14)
, test "15" <|
\() -> Expect.equal "PlingPlang" (raindrops 15)
, test "21" <|
\() -> Expect.equal "PlingPlong" (raindrops 21)
, test "25" <|
\() -> Expect.equal "Plang" (raindrops 25)
, test "35" <|
\() -> Expect.equal "PlangPlong" (raindrops 35)
, test "49" <|
\() -> Expect.equal "Plong" (raindrops 49)
, test "52" <|
\() -> Expect.equal "52" (raindrops 52)
, test "105" <|
\() -> Expect.equal "PlingPlangPlong" (raindrops 105)
]
main : Program Never
main =
runSuite tests
run emit tests
port emit : ( String, Value ) -> Cmd msg

7
exercises/raindrops/elm-package.json
View file

@ -1,5 +1,5 @@
{
"version": "2.0.0",
"version": "3.0.0",
"summary": "Exercism problems in Elm.",
"repository": "https://github.com/exercism/xelm.git",
"license": "BSD3",
@ -8,8 +8,9 @@
],
"exposed-modules": [],
"dependencies": {
"elm-community/elm-test": "1.0.0 <= v < 2.0.0",
"elm-lang/core": "4.0.0 <= v < 5.0.0"
"elm-lang/core": "4.0.0 <= v < 5.0.0",
"elm-community/elm-test": "2.0.0 <= v < 3.0.0",
"rtfeldman/node-test-runner": "1.0.0 <= v < 2.0.0"
},
"elm-version": "0.17.0 <= v < 0.18.0"
}

4
exercises/raindrops/runtests.bat
View file

@ -1,4 +0,0 @@
@echo off
for %%f in (*Tests.elm) do (
elm-make %%f --yes --output build.js && node build.js
)

2
exercises/raindrops/runtests.sh
View file

@ -1,2 +0,0 @@
#!/usr/bin/env bash
elm-make *Tests.elm --yes --output build.js && node build.js

42
exercises/rna-transcription/RNATranscriptionTests.elm
View file

@ -1,29 +1,35 @@
module Main exposing (..)
port module Main exposing (..)
import ElmTest exposing (..)
import Test.Runner.Node exposing (run)
import Json.Encode exposing (Value)
import Test exposing (..)
import Expect
import RNATranscription exposing (toRNA)
tests : Test
tests =
suite "RNATranscription"
[ test "complement of cytosine is guanine"
(assertEqual (Ok "G") (toRNA "C"))
, test "complement of guanine is cytosine"
(assertEqual (Ok "C") (toRNA "G"))
, test "complement of thymine is adenine"
(assertEqual (Ok "A") (toRNA "T"))
, test "complement of adenine is uracil"
(assertEqual (Ok "U") (toRNA "A"))
, test "complement"
(assertEqual (Ok "UGCACCAGAAUU") (toRNA "ACGTGGTCTTAA"))
, test "correctly handles completely invalid input"
(assertEqual (Err 'X') (toRNA "XXX"))
, test "correctly handles partially invalid input"
(assertEqual (Err 'U') (toRNA "UGAAXXXGACAUG"))
describe "RNATranscription"
[ test "complement of cytosine is guanine" <|
\() -> Expect.equal (Ok "G") (toRNA "C")
, test "complement of guanine is cytosine" <|
\() -> Expect.equal (Ok "C") (toRNA "G")
, test "complement of thymine is adenine" <|
\() -> Expect.equal (Ok "A") (toRNA "T")
, test "complement of adenine is uracil" <|
\() -> Expect.equal (Ok "U") (toRNA "A")
, test "complement" <|
\() -> Expect.equal (Ok "UGCACCAGAAUU") (toRNA "ACGTGGTCTTAA")
, test "correctly handles completely invalid input" <|
\() -> Expect.equal (Err 'X') (toRNA "XXX")
, test "correctly handles partially invalid input" <|
\() -> Expect.equal (Err 'U') (toRNA "UGAAXXXGACAUG")
]
main : Program Never
main =
runSuite tests
run emit tests
port emit : ( String, Value ) -> Cmd msg

7
exercises/rna-transcription/elm-package.json
View file

@ -1,5 +1,5 @@
{
"version": "2.0.0",
"version": "3.0.0",
"summary": "Exercism problems in Elm.",
"repository": "https://github.com/exercism/xelm.git",
"license": "BSD3",
@ -8,8 +8,9 @@
],
"exposed-modules": [],
"dependencies": {
"elm-community/elm-test": "1.0.0 <= v < 2.0.0",
"elm-lang/core": "4.0.0 <= v < 5.0.0"
"elm-lang/core": "4.0.0 <= v < 5.0.0",
"elm-community/elm-test": "2.0.0 <= v < 3.0.0",
"rtfeldman/node-test-runner": "1.0.0 <= v < 2.0.0"
},
"elm-version": "0.17.0 <= v < 0.18.0"
}

4
exercises/rna-transcription/runtests.bat
View file

@ -1,4 +0,0 @@
@echo off
for %%f in (*Tests.elm) do (
elm-make %%f --yes --output build.js && node build.js
)

2
exercises/rna-transcription/runtests.sh
View file

@ -1,2 +0,0 @@
#!/usr/bin/env bash
elm-make *Tests.elm --yes --output build.js && node build.js

103
exercises/robot-simulator/RobotSimulatorTests.elm
View file

@ -1,117 +1,150 @@
module Main exposing (..)
port module Main exposing (..)
import ElmTest exposing (..)
import Test.Runner.Node exposing (run)
import Json.Encode exposing (Value)
import Test exposing (..)
import Expect
import RobotSimulator exposing (defaultRobot, Robot, Bearing(North, East, West, South), turnRight, turnLeft, advance, simulate)
tests : Test
tests =
suite "RobotSimulator"
[ suite "init"
describe "RobotSimulator"
[ describe "init"
(let
robot =
defaultRobot
in
[ test "coordinates" (assertEqual { x = 0, y = 0 } robot.coordinates)
, test "bearing" (assertEqual North robot.bearing)
[ test "coordinates" <|
\() -> Expect.equal { x = 0, y = 0 } robot.coordinates
, test "bearing" <|
\() -> Expect.equal North robot.bearing
]
)
, suite "setup"
, describe "setup"
(let
robot =
Robot South { x = -1, y = 1 }
in
[ test "coordinates" (assertEqual { x = -1, y = 1 } robot.coordinates)
, test "bearing" (assertEqual South robot.bearing)
[ test "coordinates" <|
\() -> Expect.equal { x = -1, y = 1 } robot.coordinates
, test "bearing" <|
\() -> Expect.equal South robot.bearing
]
)
, suite "turn right"
, describe "turn right"
([1..3]
|> List.scanl (\_ r -> turnRight r) defaultRobot
|> List.map .bearing
|> assertionList [ North, East, South, West ]
|> List.map defaultTest
|> List.indexedMap (\i e -> test ("step " ++ toString i) (\() -> e))
)
, suite "turn left"
, describe
"turn left"
([1..3]
|> List.scanl (\_ r -> turnLeft r) defaultRobot
|> List.map .bearing
|> assertionList [ North, West, South, East ]
|> List.map defaultTest
|> List.indexedMap (\i e -> test ("step " ++ toString i) (\() -> e))
)
, suite "advance positive north"
, describe "advance positive north"
(let
robot =
Robot North { x = 0, y = 0 }
|> advance
in
[ test "coordinates" (assertEqual { x = 0, y = 1 } robot.coordinates)
, test "bearing" (assertEqual North robot.bearing)
[ test "coordinates" <|
\() -> Expect.equal { x = 0, y = 1 } robot.coordinates
, test "bearing" <|
\() -> Expect.equal North robot.bearing
]
)
, suite "advance positive east"
, describe "advance positive east"
(let
robot =
Robot East { x = 0, y = 0 }
|> advance
in
[ test "coordinates" (assertEqual { x = 1, y = 0 } robot.coordinates)
, test "bearing" (assertEqual East robot.bearing)
[ test "coordinates" <|
\() -> Expect.equal { x = 1, y = 0 } robot.coordinates
, test "bearing" <|
\() -> Expect.equal East robot.bearing
]
)
, suite "advance negative south"
, describe "advance negative south"
(let
robot =
Robot South { x = 0, y = 0 }
|> advance
in
[ test "coordinates" (assertEqual { x = 0, y = -1 } robot.coordinates)
, test "bearing" (assertEqual South robot.bearing)
[ test "coordinates" <|
\() -> Expect.equal { x = 0, y = -1 } robot.coordinates
, test "bearing" <|
\() -> Expect.equal South robot.bearing
]
)
, suite "advance positive west"
, describe "advance positive west"
(let
robot =
Robot West { x = 0, y = 0 }
|> advance
in
[ test "coordinates" (assertEqual { x = -1, y = 0 } robot.coordinates)
, test "bearing" (assertEqual West robot.bearing)
[ test "coordinates" <|
\() -> Expect.equal { x = -1, y = 0 } robot.coordinates
, test "bearing" <|
\() -> Expect.equal West robot.bearing
]
)
, suite "simulate prog 1"
, describe "simulate prog 1"
(let
robot =
Robot North { x = 0, y = 0 }
|> simulate "LAAARALA"
in
[ test "coordinates" (assertEqual { x = -4, y = 1 } robot.coordinates)
, test "bearing" (assertEqual West robot.bearing)
[ test "coordinates" <|
\() -> Expect.equal { x = -4, y = 1 } robot.coordinates
, test "bearing" <|
\() -> Expect.equal West robot.bearing
]
)
, suite "simulate prog 2"
, describe "simulate prog 2"
(let
robot =
Robot East { x = 2, y = -7 }
|> simulate "RRAAAAALA"
in
[ test "coordinates" (assertEqual { x = -3, y = -8 } robot.coordinates)
, test "bearing" (assertEqual South robot.bearing)
[ test "coordinates" <|
\() -> Expect.equal { x = -3, y = -8 } robot.coordinates
, test "bearing" <|
\() -> Expect.equal South robot.bearing
]
)
, suite "simulate prog 3"
, describe "simulate prog 3"
(let
robot =
Robot South { x = 8, y = 4 }
|> simulate "LAAARRRALLLL"
in
[ test "coordinates" (assertEqual { x = 11, y = 5 } robot.coordinates)
, test "bearing" (assertEqual North robot.bearing)
[ test "coordinates" <|
\() -> Expect.equal { x = 11, y = 5 } robot.coordinates
, test "bearing" <|
\() -> Expect.equal North robot.bearing
]
)
]
{-| Given a list of values and another list of expected values,
generate a list of Assert Equal assertions.
-}
assertionList : List a -> List a -> List Expect.Expectation
assertionList xs ys =
List.map2 Expect.equal xs ys
main : Program Never
main =
runSuite tests
run emit tests
port emit : ( String, Value ) -> Cmd msg

7
exercises/robot-simulator/elm-package.json
View file

@ -1,5 +1,5 @@
{
"version": "2.0.0",
"version": "3.0.0",
"summary": "Exercism problems in Elm.",
"repository": "https://github.com/exercism/xelm.git",
"license": "BSD3",
@ -8,8 +8,9 @@
],
"exposed-modules": [],
"dependencies": {
"elm-community/elm-test": "1.0.0 <= v < 2.0.0",
"elm-lang/core": "4.0.0 <= v < 5.0.0"
"elm-lang/core": "4.0.0 <= v < 5.0.0",
"elm-community/elm-test": "2.0.0 <= v < 3.0.0",
"rtfeldman/node-test-runner": "1.0.0 <= v < 2.0.0"
},
"elm-version": "0.17.0 <= v < 0.18.0"
}

4
exercises/robot-simulator/runtests.bat
View file

@ -1,4 +0,0 @@
@echo off
for %%f in (*Tests.elm) do (
elm-make %%f --yes --output build.js && node build.js
)

2
exercises/robot-simulator/runtests.sh
View file

@ -1,2 +0,0 @@
#!/usr/bin/env bash
elm-make *Tests.elm --yes --output build.js && node build.js

68
exercises/roman-numerals/RomanNumerals.example
View file

@ -6,41 +6,45 @@ import Maybe
toRoman : Int -> String
toRoman number =
if number == 0 then
""
else
let
part = largestFactor number
letter =
numerals
|> Dict.get part
|> Maybe.withDefault ""
in
letter ++ (toRoman (number - part))
if number == 0 then
""
else
let
part =
largestFactor number
letter =
numerals
|> Dict.get part
|> Maybe.withDefault ""
in
letter ++ (toRoman (number - part))
largestFactor : Int -> Int
largestFactor number =
numerals
|> Dict.keys
|> List.filter (\p -> p <= number)
|> List.reverse
|> List.head
|> Maybe.withDefault 0
numerals
|> Dict.keys
|> List.filter (\p -> p <= number)
|> List.reverse
|> List.head
|> Maybe.withDefault 0
numerals : Dict.Dict Int String
numerals = Dict.fromList [
(1000, "M"),
( 900, "CM"),
( 500, "D"),
( 400, "CD"),
( 100, "C"),
( 90, "XC"),
( 50, "L"),
( 40, "XL"),
( 10, "X"),
( 9, "IX"),
( 5, "V"),
( 4, "IV"),
( 1, "I")
]
numerals =
Dict.fromList
[ ( 1000, "M" )
, ( 900, "CM" )
, ( 500, "D" )
, ( 400, "CD" )
, ( 100, "C" )
, ( 90, "XC" )
, ( 50, "L" )
, ( 40, "XL" )
, ( 10, "X" )
, ( 9, "IX" )
, ( 5, "V" )
, ( 4, "IV" )
, ( 1, "I" )
]

159
exercises/roman-numerals/RomanNumeralsTests.elm
View file

@ -1,86 +1,93 @@
module Main exposing (..)
port module Main exposing (..)
import ElmTest exposing (..)
import Test.Runner.Node exposing (run)
import Json.Encode exposing (Value)
import Test exposing (..)
import Expect
import RomanNumerals exposing (toRoman)
tests : Test
tests =
suite "Roman Numerals"
[ test "1"
(assertEqual ("I")
(toRoman 1)
)
, test "2"
(assertEqual ("II")
(toRoman 2)
)
, test "3"
(assertEqual ("III")
(toRoman 3)
)
, test "4"
(assertEqual ("IV")
(toRoman 4)
)
, test "5"
(assertEqual ("V")
(toRoman 5)
)
, test "6"
(assertEqual ("VI")
(toRoman 6)
)
, test "9"
(assertEqual ("IX")
(toRoman 9)
)
, test "27"
(assertEqual ("XXVII")
(toRoman 27)
)
, test "48"
(assertEqual ("XLVIII")
(toRoman 48)
)
, test "59"
(assertEqual ("LIX")
(toRoman 59)
)
, test "93"
(assertEqual ("XCIII")
(toRoman 93)
)
, test "141"
(assertEqual ("CXLI")
(toRoman 141)
)
, test "163"
(assertEqual ("CLXIII")
(toRoman 163)
)
, test "402"
(assertEqual ("CDII")
(toRoman 402)
)
, test "575"
(assertEqual ("DLXXV")
(toRoman 575)
)
, test "911"
(assertEqual ("CMXI")
(toRoman 911)
)
, test "1024"
(assertEqual ("MXXIV")
(toRoman 1024)
)
, test "3000"
(assertEqual ("MMM")
(toRoman 3000)
)
describe "Roman Numerals"
[ test "1" <|
\() ->
Expect.equal ("I")
(toRoman 1)
, test "2" <|
\() ->
Expect.equal ("II")
(toRoman 2)
, test "3" <|
\() ->
Expect.equal ("III")
(toRoman 3)
, test "4" <|
\() ->
Expect.equal ("IV")
(toRoman 4)
, test "5" <|
\() ->
Expect.equal ("V")
(toRoman 5)
, test "6" <|
\() ->
Expect.equal ("VI")
(toRoman 6)
, test "9" <|
\() ->
Expect.equal ("IX")
(toRoman 9)
, test "27" <|
\() ->
Expect.equal ("XXVII")
(toRoman 27)
, test "48" <|
\() ->
Expect.equal ("XLVIII")
(toRoman 48)
, test "59" <|
\() ->
Expect.equal ("LIX")
(toRoman 59)
, test "93" <|
\() ->
Expect.equal ("XCIII")
(toRoman 93)
, test "141" <|
\() ->
Expect.equal ("CXLI")
(toRoman 141)
, test "163" <|
\() ->
Expect.equal ("CLXIII")
(toRoman 163)
, test "402" <|
\() ->
Expect.equal ("CDII")
(toRoman 402)
, test "575" <|
\() ->
Expect.equal ("DLXXV")
(toRoman 575)
, test "911" <|
\() ->
Expect.equal ("CMXI")
(toRoman 911)
, test "1024" <|
\() ->
Expect.equal ("MXXIV")
(toRoman 1024)
, test "3000" <|
\() ->
Expect.equal ("MMM")
(toRoman 3000)
]
main : Program Never
main =
runSuite tests
run emit tests
port emit : ( String, Value ) -> Cmd msg

7
exercises/roman-numerals/elm-package.json
View file

@ -1,5 +1,5 @@
{
"version": "2.0.0",
"version": "3.0.0",
"summary": "Exercism problems in Elm.",
"repository": "https://github.com/exercism/xelm.git",
"license": "BSD3",
@ -8,8 +8,9 @@
],
"exposed-modules": [],
"dependencies": {
"elm-community/elm-test": "1.0.0 <= v < 2.0.0",
"elm-lang/core": "4.0.0 <= v < 5.0.0"
"elm-lang/core": "4.0.0 <= v < 5.0.0",
"elm-community/elm-test": "2.0.0 <= v < 3.0.0",
"rtfeldman/node-test-runner": "1.0.0 <= v < 2.0.0"
},
"elm-version": "0.17.0 <= v < 0.18.0"
}

4
exercises/roman-numerals/runtests.bat
View file

@ -1,4 +0,0 @@
@echo off
for %%f in (*Tests.elm) do (
elm-make %%f --yes --output build.js && node build.js
)

2
exercises/roman-numerals/runtests.sh
View file

@ -1,2 +0,0 @@
#!/usr/bin/env bash
elm-make *Tests.elm --yes --output build.js && node build.js

66
exercises/run-length-encoding/RunLengthEncodingTests.elm
View file

@ -1,41 +1,47 @@
module Main exposing (..)
port module Main exposing (..)
import ElmTest exposing (..)
import Test.Runner.Node exposing (run)
import Json.Encode exposing (Value)
import Test exposing (..)
import Expect
import RunLengthEncoding exposing (version, decode, encode)
tests : Test
tests =
suite "RunLengthEncoding"
[ test "the solution is for the correct version of the test"
(assertEqual 2 version)
, test "encode simple"
(assertEqual "2A3B4C" (encode "AABBBCCCC"))
, test "decode simple"
(assertEqual "AABBBCCCC" (decode "2A3B4C"))
, test "encode with single values"
(assertEqual "12WB12W3B24WB"
(encode "WWWWWWWWWWWWBWWWWWWWWWWWWBBBWWWWWWWWWWWWWWWWWWWWWWWWB")
)
, test "decode with single values"
(assertEqual "WWWWWWWWWWWWBWWWWWWWWWWWWBBBWWWWWWWWWWWWWWWWWWWWWWWWB"
(decode "12WB12W3B24WB")
)
, test "(decode (encode (...)) combination"
(assertEqual "zzz ZZ zZ"
(decode (encode "zzz ZZ zZ"))
)
, test "decode with a x10 value"
(assertEqual "WWWWWWWWWW"
(decode "10W")
)
, test "encode unicode"
(assertEqual "⏰3⚽2⭐⏰" (encode "⏰⚽⚽⚽⭐⭐⏰"))
, test "decode unicode"
(assertEqual "⏰⚽⚽⚽⭐⭐⏰" (decode "⏰3⚽2⭐⏰"))
describe "RunLengthEncoding"
[ test "the solution is for the correct version of the test" <|
\() -> Expect.equal 2 version
, test "encode simple" <|
\() -> Expect.equal "2A3B4C" (encode "AABBBCCCC")
, test "decode simple" <|
\() -> Expect.equal "AABBBCCCC" (decode "2A3B4C")
, test "encode with single values" <|
\() ->
Expect.equal "12WB12W3B24WB"
(encode "WWWWWWWWWWWWBWWWWWWWWWWWWBBBWWWWWWWWWWWWWWWWWWWWWWWWB")
, test "decode with single values" <|
\() ->
Expect.equal "WWWWWWWWWWWWBWWWWWWWWWWWWBBBWWWWWWWWWWWWWWWWWWWWWWWWB"
(decode "12WB12W3B24WB")
, test "(decode (encode (...)) combination" <|
\() ->
Expect.equal "zzz ZZ zZ"
(decode (encode "zzz ZZ zZ"))
, test "decode with a x10 value" <|
\() ->
Expect.equal "WWWWWWWWWW"
(decode "10W")
, test "encode unicode" <|
\() -> Expect.equal "⏰3⚽2⭐⏰" (encode "⏰⚽⚽⚽⭐⭐⏰")
, test "decode unicode" <|
\() -> Expect.equal "⏰⚽⚽⚽⭐⭐⏰" (decode "⏰3⚽2⭐⏰")
]
main : Program Never
main =
runSuite tests
run emit tests
port emit : ( String, Value ) -> Cmd msg

7
exercises/run-length-encoding/elm-package.json
View file

@ -1,5 +1,5 @@
{
"version": "2.0.0",
"version": "3.0.0",
"summary": "Exercism problems in Elm.",
"repository": "https://github.com/exercism/xelm.git",
"license": "BSD3",
@ -8,8 +8,9 @@
],
"exposed-modules": [],
"dependencies": {
"elm-community/elm-test": "1.0.0 <= v < 2.0.0",
"elm-lang/core": "4.0.0 <= v < 5.0.0"
"elm-lang/core": "4.0.0 <= v < 5.0.0",
"elm-community/elm-test": "2.0.0 <= v < 3.0.0",
"rtfeldman/node-test-runner": "1.0.0 <= v < 2.0.0"
},
"elm-version": "0.17.0 <= v < 0.18.0"
}

4
exercises/run-length-encoding/runtests.bat
View file

@ -1,4 +0,0 @@
@echo off
for %%f in (*Tests.elm) do (
elm-make %%f --yes --output build.js && node build.js
)

2
exercises/run-length-encoding/runtests.sh
View file

@ -1,2 +0,0 @@
#!/usr/bin/env bash
elm-make *Tests.elm --yes --output build.js && node build.js

162
exercises/say/SayTests.elm
View file

@ -1,90 +1,96 @@
module Main exposing (..)
port module Main exposing (..)
import ElmTest exposing (..)
import Test.Runner.Node exposing (run)
import Json.Encode exposing (Value)
import Test exposing (..)
import Expect
import Say exposing (say, SayError(Negative, TooLarge))
tests : Test
tests =
suite "Series"
[ test "one"
(assertEqual (Ok "one")
(say 1)
)
, test "fourteen"
(assertEqual (Ok "fourteen")
(say 14)
)
, test "twenty"
(assertEqual (Ok "twenty")
(say 20)
)
, test "twenty-two"
(assertEqual (Ok "twenty-two")
(say 22)
)
, test "one hundred"
(assertEqual (Ok "one hundred")
(say 100)
)
, test "one hundred twenty"
(assertEqual (Ok "one hundred and twenty")
(say 120)
)
, test "one hundred twenty-three"
(assertEqual (Ok "one hundred and twenty-three")
(say 123)
)
, test "one thousand"
(assertEqual (Ok "one thousand")
(say 1000)
)
, test "one thousand two hundred thirty-four"
(assertEqual (Ok "one thousand two hundred and thirty-four")
(say 1234)
)
, test "one million"
(assertEqual (Ok "one million")
(say 1000000)
)
, test "one million two"
(assertEqual (Ok "one million and two")
(say 1000002)
)
, test "1002345"
(assertEqual (Ok "one million two thousand three hundred and forty-five")
(say 1002345)
)
, test "one billion"
(assertEqual (Ok "one billion")
(say 1000000000)
)
, test "number too large"
(assertEqual (Err TooLarge)
(say 10000000000000000)
)
, test "negative number"
(assertEqual (Err Negative)
(say -42)
)
, test "zero"
(assertEqual (Ok "zero")
(say 0)
)
, test "987654321123"
(assertEqual
(Ok
("nine hundred and eighty-seven billion "
++ "six hundred and fifty-four million "
++ "three hundred and twenty-one thousand "
++ "one hundred and twenty-three"
describe "Series"
[ test "one" <|
\() ->
Expect.equal (Ok "one")
(say 1)
, test "fourteen" <|
\() ->
Expect.equal (Ok "fourteen")
(say 14)
, test "twenty" <|
\() ->
Expect.equal (Ok "twenty")
(say 20)
, test "twenty-two" <|
\() ->
Expect.equal (Ok "twenty-two")
(say 22)
, test "one hundred" <|
\() ->
Expect.equal (Ok "one hundred")
(say 100)
, test "one hundred twenty" <|
\() ->
Expect.equal (Ok "one hundred and twenty")
(say 120)
, test "one hundred twenty-three" <|
\() ->
Expect.equal (Ok "one hundred and twenty-three")
(say 123)
, test "one thousand" <|
\() ->
Expect.equal (Ok "one thousand")
(say 1000)
, test "one thousand two hundred thirty-four" <|
\() ->
Expect.equal (Ok "one thousand two hundred and thirty-four")
(say 1234)
, test "one million" <|
\() ->
Expect.equal (Ok "one million")
(say 1000000)
, test "one million two" <|
\() ->
Expect.equal (Ok "one million and two")
(say 1000002)
, test "1002345" <|
\() ->
Expect.equal (Ok "one million two thousand three hundred and forty-five")
(say 1002345)
, test "one billion" <|
\() ->
Expect.equal (Ok "one billion")
(say 1000000000)
, test "number too large" <|
\() ->
Expect.equal (Err TooLarge)
(say 10000000000000000)
, test "negative number" <|
\() ->
Expect.equal (Err Negative)
(say -42)
, test "zero" <|
\() ->
Expect.equal (Ok "zero")
(say 0)
, test "987654321123" <|
\() ->
Expect.equal
(Ok
("nine hundred and eighty-seven billion "
++ "six hundred and fifty-four million "
++ "three hundred and twenty-one thousand "
++ "one hundred and twenty-three"
)
)
)
(say 987654321123)
)
(say 987654321123)
]
main : Program Never
main =
runSuite tests
run emit tests
port emit : ( String, Value ) -> Cmd msg

7
exercises/say/elm-package.json
View file

@ -1,5 +1,5 @@
{
"version": "2.0.0",
"version": "3.0.0",
"summary": "Exercism problems in Elm.",
"repository": "https://github.com/exercism/xelm.git",
"license": "BSD3",
@ -8,8 +8,9 @@
],
"exposed-modules": [],
"dependencies": {
"elm-community/elm-test": "1.0.0 <= v < 2.0.0",
"elm-lang/core": "4.0.0 <= v < 5.0.0"
"elm-lang/core": "4.0.0 <= v < 5.0.0",
"elm-community/elm-test": "2.0.0 <= v < 3.0.0",
"rtfeldman/node-test-runner": "1.0.0 <= v < 2.0.0"
},
"elm-version": "0.17.0 <= v < 0.18.0"
}

4
exercises/say/runtests.bat
View file

@ -1,4 +0,0 @@
@echo off
for %%f in (*Tests.elm) do (
elm-make %%f --yes --output build.js && node build.js
)

2
exercises/say/runtests.sh
View file

@ -1,2 +0,0 @@
#!/usr/bin/env bash
elm-make *Tests.elm --yes --output build.js && node build.js

78
exercises/series/SeriesTests.elm
View file

@ -1,47 +1,53 @@
module Main exposing (..)
port module Main exposing (..)
import ElmTest exposing (..)
import Test.Runner.Node exposing (run)
import Json.Encode exposing (Value)
import Test exposing (..)
import Expect
import Series exposing (slices)
tests : Test
tests =
suite "Series"
[ test "slices of one"
(assertEqual (Ok [ [ 0 ], [ 1 ], [ 2 ], [ 3 ], [ 4 ] ])
(slices 1 "01234")
)
, test "slices of two"
(assertEqual (Ok [ [ 9, 7 ], [ 7, 8 ], [ 8, 6 ], [ 6, 7 ], [ 7, 5 ], [ 5, 6 ], [ 6, 4 ] ])
(slices 2 "97867564")
)
, test "slices of three"
(assertEqual (Ok [ [ 9, 7, 8 ], [ 7, 8, 6 ], [ 8, 6, 7 ], [ 6, 7, 5 ], [ 7, 5, 6 ], [ 5, 6, 4 ] ])
(slices 3 "97867564")
)
, test "slices of four"
(assertEqual (Ok [ [ 0, 1, 2, 3 ], [ 1, 2, 3, 4 ] ])
(slices 4 "01234")
)
, test "slices of five"
(assertEqual (Ok [ [ 0, 1, 2, 3, 4 ] ])
(slices 5 "01234")
)
, test "overly long slice"
(assertEqual (Ok [])
(slices 4 "012")
)
, test "overly short slice"
(assertEqual (Err ("Invalid size: 0"))
(slices 0 "01234")
)
, test "input has non numbers"
(assertEqual (Err "could not convert string 'a' to an Int")
(slices 2 "0123abc")
)
describe "Series"
[ test "slices of one" <|
\() ->
Expect.equal (Ok [ [ 0 ], [ 1 ], [ 2 ], [ 3 ], [ 4 ] ])
(slices 1 "01234")
, test "slices of two" <|
\() ->
Expect.equal (Ok [ [ 9, 7 ], [ 7, 8 ], [ 8, 6 ], [ 6, 7 ], [ 7, 5 ], [ 5, 6 ], [ 6, 4 ] ])
(slices 2 "97867564")
, test "slices of three" <|
\() ->
Expect.equal (Ok [ [ 9, 7, 8 ], [ 7, 8, 6 ], [ 8, 6, 7 ], [ 6, 7, 5 ], [ 7, 5, 6 ], [ 5, 6, 4 ] ])
(slices 3 "97867564")
, test "slices of four" <|
\() ->
Expect.equal (Ok [ [ 0, 1, 2, 3 ], [ 1, 2, 3, 4 ] ])
(slices 4 "01234")
, test "slices of five" <|
\() ->
Expect.equal (Ok [ [ 0, 1, 2, 3, 4 ] ])
(slices 5 "01234")
, test "overly long slice" <|
\() ->
Expect.equal (Ok [])
(slices 4 "012")
, test "overly short slice" <|
\() ->
Expect.equal (Err ("Invalid size: 0"))
(slices 0 "01234")
, test "input has non numbers" <|
\() ->
Expect.equal (Err "could not convert string 'a' to an Int")
(slices 2 "0123abc")
]
main : Program Never
main =
runSuite tests
run emit tests
port emit : ( String, Value ) -> Cmd msg

7
exercises/series/elm-package.json
View file

@ -1,5 +1,5 @@
{
"version": "2.0.0",
"version": "3.0.0",
"summary": "Exercism problems in Elm.",
"repository": "https://github.com/exercism/xelm.git",
"license": "BSD3",
@ -8,8 +8,9 @@
],
"exposed-modules": [],
"dependencies": {
"elm-community/elm-test": "1.0.0 <= v < 2.0.0",
"elm-lang/core": "4.0.0 <= v < 5.0.0"
"elm-lang/core": "4.0.0 <= v < 5.0.0",
"elm-community/elm-test": "2.0.0 <= v < 3.0.0",
"rtfeldman/node-test-runner": "1.0.0 <= v < 2.0.0"
},
"elm-version": "0.17.0 <= v < 0.18.0"
}

4
exercises/series/runtests.bat
View file

@ -1,4 +0,0 @@
@echo off
for %%f in (*Tests.elm) do (
elm-make %%f --yes --output build.js && node build.js
)

2
exercises/series/runtests.sh
View file

@ -1,2 +0,0 @@
#!/usr/bin/env bash
elm-make *Tests.elm --yes --output build.js && node build.js

46
exercises/space-age/SpaceAgeTests.elm
View file

@ -1,31 +1,37 @@
module Main exposing (..)
port module Main exposing (..)
import ElmTest exposing (..)
import Test.Runner.Node exposing (run)
import Json.Encode exposing (Value)
import Test exposing (..)
import Expect
import SpaceAge exposing (Planet(..), ageOn)
tests : Test
tests =
suite "SpaceAge"
[ test "age in earth years"
(assertEqual 32 (round (ageOn Earth 1000000000)))
, test "age in mercury years"
(assertEqual 281 (round (ageOn Mercury 2134835688)))
, test "age in venus years"
(assertEqual 10 (round (ageOn Venus 189839836)))
, test "age on mars"
(assertEqual 39 (round (ageOn Mars 2329871239)))
, test "age on jupiter"
(assertEqual 2 (round (ageOn Jupiter 901876382)))
, test "age on saturn"
(assertEqual 3 (round (ageOn Saturn 3000000000)))
, test "age on uranus"
(assertEqual 1 (round (ageOn Uranus 3210123456)))
, test "age on neptune"
(assertEqual 2 (round (ageOn Neptune 8210123456)))
describe "SpaceAge"
[ test "age in earth years" <|
\() -> Expect.equal 32 (round (ageOn Earth 1000000000))
, test "age in mercury years" <|
\() -> Expect.equal 281 (round (ageOn Mercury 2134835688))
, test "age in venus years" <|
\() -> Expect.equal 10 (round (ageOn Venus 189839836))
, test "age on mars" <|
\() -> Expect.equal 39 (round (ageOn Mars 2329871239))
, test "age on jupiter" <|
\() -> Expect.equal 2 (round (ageOn Jupiter 901876382))
, test "age on saturn" <|
\() -> Expect.equal 3 (round (ageOn Saturn 3000000000))
, test "age on uranus" <|
\() -> Expect.equal 1 (round (ageOn Uranus 3210123456))
, test "age on neptune" <|
\() -> Expect.equal 2 (round (ageOn Neptune 8210123456))
]
main : Program Never
main =
runSuite tests
run emit tests
port emit : ( String, Value ) -> Cmd msg

7
exercises/space-age/elm-package.json
View file

@ -1,5 +1,5 @@
{
"version": "2.0.0",
"version": "3.0.0",
"summary": "Exercism problems in Elm.",
"repository": "https://github.com/exercism/xelm.git",
"license": "BSD3",
@ -8,8 +8,9 @@
],
"exposed-modules": [],
"dependencies": {
"elm-community/elm-test": "1.0.0 <= v < 2.0.0",
"elm-lang/core": "4.0.0 <= v < 5.0.0"
"elm-lang/core": "4.0.0 <= v < 5.0.0",
"elm-community/elm-test": "2.0.0 <= v < 3.0.0",
"rtfeldman/node-test-runner": "1.0.0 <= v < 2.0.0"
},
"elm-version": "0.17.0 <= v < 0.18.0"
}

4
exercises/space-age/runtests.bat
View file

@ -1,4 +0,0 @@
@echo off
for %%f in (*Tests.elm) do (
elm-make %%f --yes --output build.js && node build.js
)

2
exercises/space-age/runtests.sh
View file

@ -1,2 +0,0 @@
#!/usr/bin/env bash
elm-make *Tests.elm --yes --output build.js && node build.js

110
exercises/strain/StrainTests.elm
View file

@ -1,6 +1,9 @@
module Main exposing (..)
port module Main exposing (..)
import ElmTest exposing (..)
import Test.Runner.Node exposing (run)
import Json.Encode exposing (Value)
import Test exposing (..)
import Expect
import Strain exposing (keep, discard)
import String
@ -27,58 +30,61 @@ lessThanTen num =
tests : Test
tests =
suite "Strain"
[ test "empty keep"
(assertEqual []
(keep lessThanTen [])
)
, test "keep everything"
(assertEqual [ 1, 2, 3 ]
(keep lessThanTen [ 1, 2, 3 ])
)
, test "keep first and last"
(assertEqual [ 1, 3 ]
(keep odd [ 1, 2, 3 ])
)
, test "keep nothing"
(assertEqual []
(keep even [ 1, 3, 5, 7 ])
)
, test "keep neither first nor last"
(assertEqual [ 2 ]
(keep even [ 1, 2, 3 ])
)
, test "keep strings"
(assertEqual [ "zebra", "zombies", "zealot" ]
(keep (isFirstLetter "z") [ "apple", "zebra", "banana", "zombies", "cherimoya", "zealot" ])
)
, test "empty discard"
(assertEqual []
(discard lessThanTen [])
)
, test "discard everything"
(assertEqual []
(discard lessThanTen [ 1, 2, 3 ])
)
, test "discard first and last"
(assertEqual [ 2 ]
(discard odd [ 1, 2, 3 ])
)
, test "discard nothing"
(assertEqual [ 1, 3, 5, 7 ]
(discard even [ 1, 3, 5, 7 ])
)
, test "discard neither first nor last"
(assertEqual [ 1, 3 ]
(discard even [ 1, 2, 3 ])
)
, test "discard strings"
(assertEqual [ "apple", "banana", "cherimoya" ]
(discard (isFirstLetter "z") [ "apple", "zebra", "banana", "zombies", "cherimoya", "zealot" ])
)
describe "Strain"
[ test "empty keep" <|
\() ->
Expect.equal []
(keep lessThanTen [])
, test "keep everything" <|
\() ->
Expect.equal [ 1, 2, 3 ]
(keep lessThanTen [ 1, 2, 3 ])
, test "keep first and last" <|
\() ->
Expect.equal [ 1, 3 ]
(keep odd [ 1, 2, 3 ])
, test "keep nothing" <|
\() ->
Expect.equal []
(keep even [ 1, 3, 5, 7 ])
, test "keep neither first nor last" <|
\() ->
Expect.equal [ 2 ]
(keep even [ 1, 2, 3 ])
, test "keep strings" <|
\() ->
Expect.equal [ "zebra", "zombies", "zealot" ]
(keep (isFirstLetter "z") [ "apple", "zebra", "banana", "zombies", "cherimoya", "zealot" ])
, test "empty discard" <|
\() ->
Expect.equal []
(discard lessThanTen [])
, test "discard everything" <|
\() ->
Expect.equal []
(discard lessThanTen [ 1, 2, 3 ])
, test "discard first and last" <|
\() ->
Expect.equal [ 2 ]
(discard odd [ 1, 2, 3 ])
, test "discard nothing" <|
\() ->
Expect.equal [ 1, 3, 5, 7 ]
(discard even [ 1, 3, 5, 7 ])
, test "discard neither first nor last" <|
\() ->
Expect.equal [ 1, 3 ]
(discard even [ 1, 2, 3 ])
, test "discard strings" <|
\() ->
Expect.equal [ "apple", "banana", "cherimoya" ]
(discard (isFirstLetter "z") [ "apple", "zebra", "banana", "zombies", "cherimoya", "zealot" ])
]
main : Program Never
main =
runSuite tests
run emit tests
port emit : ( String, Value ) -> Cmd msg

7
exercises/strain/elm-package.json
View file

@ -1,5 +1,5 @@
{
"version": "2.0.0",
"version": "3.0.0",
"summary": "Exercism problems in Elm.",
"repository": "https://github.com/exercism/xelm.git",
"license": "BSD3",
@ -8,8 +8,9 @@
],
"exposed-modules": [],
"dependencies": {
"elm-community/elm-test": "1.0.0 <= v < 2.0.0",
"elm-lang/core": "4.0.0 <= v < 5.0.0"
"elm-lang/core": "4.0.0 <= v < 5.0.0",
"elm-community/elm-test": "2.0.0 <= v < 3.0.0",
"rtfeldman/node-test-runner": "1.0.0 <= v < 2.0.0"
},
"elm-version": "0.17.0 <= v < 0.18.0"
}

Some files were not shown because too many files have changed in this diff Show more