Add NucleotideCount example and test

NucleotideCount/NucleotideCountExample.elm

@@ -0,0 +1,15 @@
+module NucleotideCountExample where
+
+import String
+import List
+
+nucleotideCounts : String -> List (Char, Int)
+nucleotideCounts sequence = [
+  (getCount 'A' sequence),
+  (getCount 'T' sequence),
+  (getCount 'C' sequence),
+  (getCount 'G' sequence)
+  ]
+
+getCount : Char -> String -> (Char, Int)
+getCount base sequence = (base, (List.length (String.split (String.fromChar base) sequence)) - 1)

NucleotideCount/NucleotideCountTest.elm

@@ -0,0 +1,22 @@
+module NucleotideCountTest where
+
+-- TODO - remove example inclusion once Problem sets are ready to go live or CI is set up.
+
+import NucleotideCountExample exposing (nucleotideCounts)
+
+import ElmTest.Test exposing (test, Test, suite)
+import ElmTest.Assertion exposing (assert, assertEqual)
+import ElmTest.Runner.Element exposing (runDisplay)
+
+tests : Test
+tests = suite "NucleotideCount test suite"
+      [
+        test "empty dna strand has no nucleotides" (assertEqual [('A', 0), ('T', 0), ('C', 0), ('G', 0)]
+                      (nucleotideCounts "")),
+        test "repetitive-sequence-has-only-guanosine" (assertEqual [('A', 0), ('T', 0), ('C', 0), ('G', 8)]
+                      (nucleotideCounts "GGGGGGGG")),
+        test "counts all nucleotides" (assertEqual [('A', 20), ('T', 21), ('C', 12), ('G', 17)]
+                      (nucleotideCounts "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"))
+      ]
+
+main = runDisplay tests

elm-package.json

@@ -24,7 +24,9 @@
         "Bob",
         "SumOfMultiples",
         "Strain",
-        "SpaceAge"
+        "SpaceAge",
+        "Anagram",
+        "NucleotideCount"
     ],
     "exposed-modules": [],
     "dependencies": {