elm/exercises/nucleotide-count/tests/Tests.elm
Jay Hayes 965a615782 Don't skip first _actual_ test
I failed to notice with the initial commit that the first tests in these
files are just the "version sanity check". This should start learners
off with a useful first failure.
2017-07-07 15:42:31 -05:00

27 lines
971 B
Elm

module Tests exposing (..)
import Test exposing (..)
import Expect
import NucleotideCount exposing (nucleotideCounts, version)
tests : Test
tests =
describe "NucleotideCount"
[ test "the solution is for the correct version of the test" <|
\() -> Expect.equal 2 version
, test "empty dna strand has no nucleotides" <|
\() ->
Expect.equal { a = 0, t = 0, c = 0, g = 0 }
(nucleotideCounts "")
, skip <|
test "repetitive sequence has only guanine" <|
\() ->
Expect.equal { a = 0, t = 0, c = 0, g = 8 }
(nucleotideCounts "GGGGGGGG")
, skip <|
test "counts all nucleotides" <|
\() ->
Expect.equal { a = 20, t = 21, c = 12, g = 17 }
(nucleotideCounts "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC")
]