mirror of
https://github.com/correl/elm.git
synced 2024-11-29 03:00:10 +00:00
35 lines
1.1 KiB
Elm
35 lines
1.1 KiB
Elm
port module Main exposing (..)
|
|
|
|
import Test.Runner.Node exposing (run, TestProgram)
|
|
import Json.Encode exposing (Value)
|
|
import Test exposing (..)
|
|
import Expect
|
|
import NucleotideCount exposing (nucleotideCounts, version)
|
|
|
|
|
|
tests : Test
|
|
tests =
|
|
describe "NucleotideCount"
|
|
[ test "the solution is for the correct version of the test" <|
|
|
\() -> Expect.equal 2 version
|
|
, test "empty dna strand has no nucleotides" <|
|
|
\() ->
|
|
Expect.equal { a = 0, t = 0, c = 0, g = 0 }
|
|
(nucleotideCounts "")
|
|
, test "repetitive-sequence-has-only-guanosine" <|
|
|
\() ->
|
|
Expect.equal { a = 0, t = 0, c = 0, g = 8 }
|
|
(nucleotideCounts "GGGGGGGG")
|
|
, test "counts all nucleotides" <|
|
|
\() ->
|
|
Expect.equal { a = 20, t = 21, c = 12, g = 17 }
|
|
(nucleotideCounts "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC")
|
|
]
|
|
|
|
|
|
main : TestProgram
|
|
main =
|
|
run emit tests
|
|
|
|
|
|
port emit : ( String, Value ) -> Cmd msg
|