mirror of
https://github.com/correl/elm.git
synced 2024-11-16 19:19:28 +00:00
39 lines
949 B
Elm
39 lines
949 B
Elm
module Main (..) where
|
|
|
|
import Task
|
|
import Console
|
|
import ElmTest exposing (..)
|
|
import NucleotideCount exposing (nucleotideCounts, version)
|
|
|
|
|
|
tests : Test
|
|
tests =
|
|
suite
|
|
"NucleotideCount"
|
|
[ test
|
|
"the solution is for the correct version of the test"
|
|
(assertEqual 2 version)
|
|
, test
|
|
"empty dna strand has no nucleotides"
|
|
(assertEqual
|
|
{ a = 0, t = 0, c = 0, g = 0 }
|
|
(nucleotideCounts "")
|
|
)
|
|
, test
|
|
"repetitive-sequence-has-only-guanosine"
|
|
(assertEqual
|
|
{ a = 0, t = 0, c = 0, g = 8 }
|
|
(nucleotideCounts "GGGGGGGG")
|
|
)
|
|
, test
|
|
"counts all nucleotides"
|
|
(assertEqual
|
|
{ a = 20, t = 21, c = 12, g = 17 }
|
|
(nucleotideCounts "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC")
|
|
)
|
|
]
|
|
|
|
|
|
port runner : Signal (Task.Task x ())
|
|
port runner =
|
|
Console.run (consoleRunner tests)
|