mirror of
https://github.com/correl/elm.git
synced 2025-01-09 03:00:08 +00:00
965a615782
I failed to notice with the initial commit that the first tests in these files are just the "version sanity check". This should start learners off with a useful first failure.
27 lines
971 B
Elm
27 lines
971 B
Elm
module Tests exposing (..)
|
|
|
|
import Test exposing (..)
|
|
import Expect
|
|
import NucleotideCount exposing (nucleotideCounts, version)
|
|
|
|
|
|
tests : Test
|
|
tests =
|
|
describe "NucleotideCount"
|
|
[ test "the solution is for the correct version of the test" <|
|
|
\() -> Expect.equal 2 version
|
|
, test "empty dna strand has no nucleotides" <|
|
|
\() ->
|
|
Expect.equal { a = 0, t = 0, c = 0, g = 0 }
|
|
(nucleotideCounts "")
|
|
, skip <|
|
|
test "repetitive sequence has only guanine" <|
|
|
\() ->
|
|
Expect.equal { a = 0, t = 0, c = 0, g = 8 }
|
|
(nucleotideCounts "GGGGGGGG")
|
|
, skip <|
|
|
test "counts all nucleotides" <|
|
|
\() ->
|
|
Expect.equal { a = 20, t = 21, c = 12, g = 17 }
|
|
(nucleotideCounts "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC")
|
|
]
|