mirror of
https://github.com/correl/elm.git
synced 2024-11-17 03:00:06 +00:00
23 lines
964 B
Elm
23 lines
964 B
Elm
|
module NucleotideCountTest where
|
||
|
|
||
|
-- TODO - remove example inclusion once Problem sets are ready to go live or CI is set up.
|
||
|
|
||
|
import NucleotideCountExample exposing (nucleotideCounts)
|
||
|
|
||
|
import ElmTest.Test exposing (test, Test, suite)
|
||
|
import ElmTest.Assertion exposing (assert, assertEqual)
|
||
|
import ElmTest.Runner.Element exposing (runDisplay)
|
||
|
|
||
|
tests : Test
|
||
|
tests = suite "NucleotideCount test suite"
|
||
|
[
|
||
|
test "empty dna strand has no nucleotides" (assertEqual [('A', 0), ('T', 0), ('C', 0), ('G', 0)]
|
||
|
(nucleotideCounts "")),
|
||
|
test "repetitive-sequence-has-only-guanosine" (assertEqual [('A', 0), ('T', 0), ('C', 0), ('G', 8)]
|
||
|
(nucleotideCounts "GGGGGGGG")),
|
||
|
test "counts all nucleotides" (assertEqual [('A', 20), ('T', 21), ('C', 12), ('G', 17)]
|
||
|
(nucleotideCounts "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"))
|
||
|
]
|
||
|
|
||
|
main = runDisplay tests
|