mirror of
https://github.com/correl/elm.git
synced 2024-11-17 03:00:06 +00:00
37 lines
882 B
Elm
37 lines
882 B
Elm
module Main exposing (..)
|
|
|
|
import ElmTest exposing (..)
|
|
import NucleotideCount exposing (nucleotideCounts, version)
|
|
|
|
|
|
tests : Test
|
|
tests =
|
|
suite
|
|
"NucleotideCount"
|
|
[ test
|
|
"the solution is for the correct version of the test"
|
|
(assertEqual 2 version)
|
|
, test
|
|
"empty dna strand has no nucleotides"
|
|
(assertEqual
|
|
{ a = 0, t = 0, c = 0, g = 0 }
|
|
(nucleotideCounts "")
|
|
)
|
|
, test
|
|
"repetitive-sequence-has-only-guanosine"
|
|
(assertEqual
|
|
{ a = 0, t = 0, c = 0, g = 8 }
|
|
(nucleotideCounts "GGGGGGGG")
|
|
)
|
|
, test
|
|
"counts all nucleotides"
|
|
(assertEqual
|
|
{ a = 20, t = 21, c = 12, g = 17 }
|
|
(nucleotideCounts "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC")
|
|
)
|
|
]
|
|
|
|
|
|
main : Program Never
|
|
main =
|
|
runSuite tests
|