elm/exercises/nucleotide-count/NucleotideCountTests.elm

38 lines
882 B
Elm
Raw Normal View History

module Main exposing (..)
2016-03-17 01:36:38 +00:00
import ElmTest exposing (..)
import NucleotideCount exposing (nucleotideCounts, version)
2016-03-17 01:36:38 +00:00
2016-03-17 01:36:38 +00:00
tests : Test
tests =
suite
"NucleotideCount"
[ test
"the solution is for the correct version of the test"
(assertEqual 2 version)
, test
"empty dna strand has no nucleotides"
(assertEqual
{ a = 0, t = 0, c = 0, g = 0 }
(nucleotideCounts "")
)
, test
"repetitive-sequence-has-only-guanosine"
(assertEqual
{ a = 0, t = 0, c = 0, g = 8 }
(nucleotideCounts "GGGGGGGG")
)
, test
"counts all nucleotides"
(assertEqual
{ a = 20, t = 21, c = 12, g = 17 }
(nucleotideCounts "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC")
)
]
2016-03-17 01:36:38 +00:00
main : Program Never
main =
runSuite tests